Mutagenetix > Incidental Mutation

Incidental Mutation 'R1909:Ash1l'

210122

Institutional Source

Beutler Lab

Gene Symbol

Ash1l

Ensembl Gene

ENSMUSG00000028053

Gene Name

ASH1 like histone lysine methyltransferase

Synonyms

chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik

MMRRC Submission

039928-MU

Accession Numbers

Genbank: NM_138679; MGI: 2183158

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88950622-89079375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88984528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1238 (V1238A)

Ref Sequence

ENSEMBL: ENSMUSP00000140251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090933
AA Change: V1238A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: V1238A

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186583
AA Change: V1238A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: V1238A

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	A	7: 34,258,036	I59L	probably benign	Het
9530053A07Rik	T	C	7: 28,144,348	V887A	possibly damaging	Het
Aarsd1	A	C	11: 101,410,231		probably null	Het
Abcc5	A	G	16: 20,376,509		probably null	Het
Abcc6	T	C	7: 46,020,134		probably null	Het
Adam15	C	A	3: 89,345,330	M317I	probably benign	Het
Ago3	T	C	4: 126,346,737	T111A	probably damaging	Het
Amz1	G	T	5: 140,752,461	S492I	probably benign	Het
Arid1a	T	C	4: 133,693,761	N911S	unknown	Het
Arntl2	A	T	6: 146,810,810	E111V	probably benign	Het
Ascl2	C	A	7: 142,968,163	A115S	probably damaging	Het
Asxl2	G	T	12: 3,474,577	V202F	probably damaging	Het
Atp10a	A	T	7: 58,828,712	Q1501L	probably benign	Het
Avpr1a	A	T	10: 122,452,208	I374L	probably benign	Het
Bmx	T	C	X: 164,239,415	H157R	probably benign	Het
Camk4	T	A	18: 33,158,816		probably null	Het
Ccdc103	G	A	11: 102,882,566	D5N	probably benign	Het
Ccdc186	A	T	19: 56,793,361	N70K	probably damaging	Het
Cebpz	A	T	17: 78,934,907	Y439*	probably null	Het
Cfap206	A	C	4: 34,722,714	S122R	probably benign	Het
Cnst	T	C	1: 179,622,791	S607P	probably damaging	Het
Col8a2	C	A	4: 126,312,133	D645E	possibly damaging	Het
Cpsf4l	A	T	11: 113,703,378		probably null	Het
Crim1	C	T	17: 78,313,127	T332I	probably benign	Het
Csmd1	A	T	8: 15,906,116	Y3364N	probably damaging	Het
D5Ertd579e	A	T	5: 36,614,058	S998T	probably benign	Het
Dab2ip	C	G	2: 35,718,815	A587G	probably damaging	Het
Dach1	C	T	14: 97,901,393	G486D	probably damaging	Het
Ddx24	T	C	12: 103,409,982	I752V	probably damaging	Het
Dhx33	A	G	11: 70,989,107	V359A	probably benign	Het
Dip2c	A	T	13: 9,533,350	T123S	probably benign	Het
Dync1h1	G	A	12: 110,662,629	E4207K	probably damaging	Het
Eef1b2	G	T	1: 63,177,272	D21Y	probably damaging	Het
Eif3b	T	C	5: 140,432,937	S462P	probably damaging	Het
Elmod2	G	C	8: 83,316,369	R277G	probably benign	Het
Epg5	T	A	18: 77,959,032	D555E	probably benign	Het
Ercc8	A	T	13: 108,175,566	K172*	probably null	Het
Fat3	T	C	9: 15,998,115	N2197S	probably benign	Het
Fbf1	A	G	11: 116,145,992	V972A	possibly damaging	Het
Fes	T	C	7: 80,386,861	R113G	probably damaging	Het
Fzd1	G	T	5: 4,757,481	H34N	probably benign	Het
Galnt17	T	A	5: 131,111,838	Y147F	probably benign	Het
Gdf6	T	C	4: 9,859,971	L351P	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm15448	A	T	7: 3,822,919	I317N	probably benign	Het
Gm2381	A	T	7: 42,819,928	H257Q	probably damaging	Het
Gm6904	A	T	14: 59,258,613	S17R	probably benign	Het
Gm9844	T	C	7: 24,862,306	I10T	possibly damaging	Het
Hivep1	A	T	13: 42,155,646	K454M	probably benign	Het
Hmmr	T	A	11: 40,708,098	E566D	probably damaging	Het
Hydin	T	G	8: 110,587,772	V4296G	probably damaging	Het
Il18r1	T	A	1: 40,474,914	D93E	probably damaging	Het
Iqgap1	T	C	7: 80,743,828	D667G	probably benign	Het
Lama3	T	C	18: 12,581,798	I3278T	probably benign	Het
Lrp4	T	A	2: 91,498,408	V1551D	possibly damaging	Het
Mdn1	CGGAGGAGGAGGAGGAG	CGGAGGAGGAGGAG	4: 32,760,839		probably benign	Het
Mga	T	A	2: 119,926,594	H1018Q	possibly damaging	Het
Ncoa7	A	T	10: 30,689,800	M666K	probably damaging	Het
Ndnf	T	G	6: 65,703,313	V192G	possibly damaging	Het
Nr4a1	T	A	15: 101,274,227	I594N	probably damaging	Het
Olfr1294	T	A	2: 111,538,014	I92F	probably damaging	Het
Olfr60	T	C	7: 140,345,465	I175V	probably benign	Het
Olfr618	A	G	7: 103,597,343	N9S	probably benign	Het
Olfr635	G	A	7: 103,979,790	W199*	probably null	Het
Olfr698	T	C	7: 106,752,995	N131S	probably benign	Het
Paxbp1	T	C	16: 91,044,305		probably benign	Het
Pcdhb8	A	G	18: 37,355,962	E231G	possibly damaging	Het
Pcsk5	A	T	19: 17,433,461	Y1856N	probably benign	Het
Pde3a	T	C	6: 141,250,239	V217A	probably benign	Het
Pirb	A	T	7: 3,714,588	D674E	probably benign	Het
Pnisr	T	A	4: 21,869,517	M335K	possibly damaging	Het
Pnpla7	T	A	2: 24,997,288	M48K	possibly damaging	Het
Pomgnt2	A	T	9: 121,982,191	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkca	A	T	11: 107,939,612	D217E	possibly damaging	Het
Rac3	A	C	11: 120,723,337	I142L	probably benign	Het
Ralgapb	G	T	2: 158,444,675	A347S	probably damaging	Het
Rbm43	G	C	2: 51,925,434	S258R	possibly damaging	Het
Rnf182	T	A	13: 43,668,423	V150E	probably benign	Het
Rsph10b	T	C	5: 143,985,491	F409L	probably benign	Het
Ryr2	A	T	13: 11,700,349	L2778M	probably damaging	Het
Scn1a	T	C	2: 66,331,352	N284S	possibly damaging	Het
Scyl2	A	T	10: 89,640,905	M786K	probably benign	Het
Sema4g	C	A	19: 44,997,622	R301S	probably damaging	Het
Senp6	A	T	9: 80,113,774	E245D	possibly damaging	Het
Setx	T	C	2: 29,163,009	V2095A	possibly damaging	Het
Slc13a2	A	T	11: 78,400,142	M412K	possibly damaging	Het
Slc25a4	T	C	8: 46,209,400	N74D	probably damaging	Het
Slc28a1	T	A	7: 81,142,035	F316L	probably damaging	Het
Slfn8	G	A	11: 83,003,621	Q731*	probably null	Het
Slitrk4	A	G	X: 64,272,623	I146T	probably damaging	Het
Smg1	A	G	7: 118,154,199		probably benign	Het
Smg8	G	T	11: 87,080,613	Y777*	probably null	Het
Smyd1	T	A	6: 71,239,579	K61N	probably benign	Het
Sod2	T	C	17: 13,015,169	*223R	probably null	Het
Sp6	G	T	11: 97,021,508	A16S	probably benign	Het
Spata31d1a	A	C	13: 59,702,695	Y540D	probably damaging	Het
Spatc1l	A	G	10: 76,563,917	D91G	probably damaging	Het
Spg7	A	G	8: 123,080,741	T419A	probably benign	Het
St5	G	A	7: 109,525,326	Q686*	probably null	Het
St8sia4	A	G	1: 95,627,573	I244T	probably damaging	Het
Tbl2	C	T	5: 135,152,991	R27W	probably damaging	Het
Tmed4	G	A	11: 6,274,694	P47L	probably damaging	Het
Tmtc1	T	C	6: 148,444,048	D51G	possibly damaging	Het
Ttc28	T	C	5: 111,284,054		probably null	Het
Unc13d	A	G	11: 116,070,295	F412S	probably damaging	Het
Unc45b	A	C	11: 82,926,087	K451T	probably damaging	Het
Vmn2r16	A	G	5: 109,363,987	M687V	probably benign	Het
Vmn2r68	T	A	7: 85,234,052	H164L	probably benign	Het
Vps51	A	G	19: 6,069,469	V625A	probably benign	Het
Wapl	T	A	14: 34,691,912	W244R	probably damaging	Het
Wdr75	C	T	1: 45,823,403	T794I	probably benign	Het

Other mutations in Ash1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ash1l	APN	3	88981712	missense	probably benign	0.19
IGL00819:Ash1l	APN	3	89007736	missense	possibly damaging	0.68
IGL00939:Ash1l	APN	3	89035236	missense	probably damaging	0.99
IGL01064:Ash1l	APN	3	89072484	missense	probably damaging	1.00
IGL01066:Ash1l	APN	3	88984635	missense	probably damaging	1.00
IGL01087:Ash1l	APN	3	89063902	missense	probably damaging	1.00
IGL01293:Ash1l	APN	3	88983529	missense	probably benign	0.01
IGL01541:Ash1l	APN	3	89066265	missense	probably damaging	1.00
IGL01863:Ash1l	APN	3	88985506	nonsense	probably null
IGL02326:Ash1l	APN	3	88966057	missense	probably benign	0.00
IGL02407:Ash1l	APN	3	89072548	missense	probably damaging	1.00
IGL02419:Ash1l	APN	3	88985565	missense	probably benign	0.00
IGL02422:Ash1l	APN	3	89069079	critical splice donor site	probably null
IGL02494:Ash1l	APN	3	89066218	nonsense	probably null
IGL02727:Ash1l	APN	3	89023037	missense	probably benign
IGL02732:Ash1l	APN	3	88966228	missense	probably damaging	1.00
IGL02817:Ash1l	APN	3	88984801	missense	probably damaging	1.00
IGL02887:Ash1l	APN	3	88984181	missense	probably benign	0.11
IGL03224:Ash1l	APN	3	89035268	splice site	probably benign
IGL03253:Ash1l	APN	3	88984674	missense	probably damaging	1.00
IGL03327:Ash1l	APN	3	89023083	missense	probably benign	0.02
IGL03398:Ash1l	APN	3	89007220	missense	probably benign	0.01
3-1:Ash1l	UTSW	3	88966326	missense	probably benign
BB008:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
BB018:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0395:Ash1l	UTSW	3	89058589	missense	probably damaging	1.00
R0477:Ash1l	UTSW	3	88983459	missense	probably benign	0.41
R0528:Ash1l	UTSW	3	88982277	missense	probably benign
R0543:Ash1l	UTSW	3	89063778	splice site	probably null
R0855:Ash1l	UTSW	3	89054454	missense	possibly damaging	0.82
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1163:Ash1l	UTSW	3	89035263	critical splice donor site	probably null
R1196:Ash1l	UTSW	3	88983316	missense	probably damaging	0.99
R1419:Ash1l	UTSW	3	88984897	missense	probably damaging	0.99
R1445:Ash1l	UTSW	3	89007352	missense	probably benign	0.02
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1480:Ash1l	UTSW	3	88985052	missense	probably damaging	1.00
R1506:Ash1l	UTSW	3	89058499	missense	probably damaging	0.99
R1537:Ash1l	UTSW	3	89072476	missense	probably damaging	0.99
R1584:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1669:Ash1l	UTSW	3	89067242	critical splice donor site	probably null
R1713:Ash1l	UTSW	3	89076224	missense	probably damaging	1.00
R1780:Ash1l	UTSW	3	88965984	missense	probably benign
R1793:Ash1l	UTSW	3	89070309	missense	probably damaging	1.00
R1881:Ash1l	UTSW	3	88981555	missense	probably benign	0.00
R1938:Ash1l	UTSW	3	88984422	missense	probably damaging	0.98
R2035:Ash1l	UTSW	3	89066317	missense	probably benign	0.00
R2070:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2071:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2114:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2116:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2118:Ash1l	UTSW	3	88985295	missense	possibly damaging	0.80
R2143:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2164:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2210:Ash1l	UTSW	3	89066298	missense	probably damaging	1.00
R2247:Ash1l	UTSW	3	89007367	missense	possibly damaging	0.77
R2303:Ash1l	UTSW	3	89026426	missense	probably damaging	1.00
R2860:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R2861:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R3104:Ash1l	UTSW	3	89054386	missense	probably damaging	1.00
R4133:Ash1l	UTSW	3	88982260	missense	probably benign	0.00
R4164:Ash1l	UTSW	3	88981966	missense	probably damaging	0.97
R4270:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4271:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4287:Ash1l	UTSW	3	89066415	missense	probably damaging	0.99
R4409:Ash1l	UTSW	3	89007199	missense	probably damaging	0.99
R4459:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R4487:Ash1l	UTSW	3	88985315	missense	possibly damaging	0.65
R4674:Ash1l	UTSW	3	89072476	missense	possibly damaging	0.80
R4739:Ash1l	UTSW	3	88982845	missense	probably benign	0.19
R4927:Ash1l	UTSW	3	88985334	missense	probably damaging	1.00
R5000:Ash1l	UTSW	3	89058634	missense	probably damaging	1.00
R5016:Ash1l	UTSW	3	88982323	missense	probably damaging	1.00
R5055:Ash1l	UTSW	3	89023212	critical splice donor site	probably null
R5081:Ash1l	UTSW	3	88984717	missense	probably damaging	1.00
R5082:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R5090:Ash1l	UTSW	3	89052877	missense	probably damaging	1.00
R5113:Ash1l	UTSW	3	89066275	missense	probably damaging	0.99
R5408:Ash1l	UTSW	3	88982394	missense	probably damaging	1.00
R5452:Ash1l	UTSW	3	88984876	missense	possibly damaging	0.93
R5487:Ash1l	UTSW	3	88981426	missense	probably benign	0.17
R5610:Ash1l	UTSW	3	89023185	missense	probably damaging	1.00
R5624:Ash1l	UTSW	3	88985609	missense	probably damaging	1.00
R5682:Ash1l	UTSW	3	89007607	missense	probably damaging	0.99
R5712:Ash1l	UTSW	3	89051990	missense	probably damaging	0.99
R5719:Ash1l	UTSW	3	89054498	missense	possibly damaging	0.83
R5719:Ash1l	UTSW	3	89058626	missense	probably damaging	1.00
R5839:Ash1l	UTSW	3	88983351	missense	probably damaging	0.99
R5859:Ash1l	UTSW	3	89068993	missense	probably damaging	1.00
R5877:Ash1l	UTSW	3	88981584	missense	probably benign	0.00
R5940:Ash1l	UTSW	3	88984036	missense	probably damaging	0.96
R6026:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6027:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6029:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6089:Ash1l	UTSW	3	89053143	nonsense	probably null
R6110:Ash1l	UTSW	3	88985129	missense	probably damaging	1.00
R6168:Ash1l	UTSW	3	89052773	nonsense	probably null
R6200:Ash1l	UTSW	3	89070527	missense	probably damaging	1.00
R6290:Ash1l	UTSW	3	88982761	nonsense	probably null
R6331:Ash1l	UTSW	3	89007865	missense	probably benign	0.00
R6425:Ash1l	UTSW	3	88983780	missense	probably damaging	0.99
R6540:Ash1l	UTSW	3	88985061	missense	probably damaging	1.00
R6568:Ash1l	UTSW	3	89052037	missense	probably benign	0.09
R6828:Ash1l	UTSW	3	89076113	missense	probably benign	0.00
R6843:Ash1l	UTSW	3	88985388	missense	probably damaging	1.00
R6894:Ash1l	UTSW	3	88982991	missense	probably benign	0.00
R6976:Ash1l	UTSW	3	88981657	missense	possibly damaging	0.77
R7038:Ash1l	UTSW	3	88982671	missense	probably benign	0.00
R7073:Ash1l	UTSW	3	88985340	missense	probably damaging	1.00
R7133:Ash1l	UTSW	3	88983457	frame shift	probably null
R7150:Ash1l	UTSW	3	89077074	missense	probably damaging	1.00
R7205:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R7254:Ash1l	UTSW	3	89070509	missense	probably damaging	1.00
R7272:Ash1l	UTSW	3	89054634	splice site	probably null
R7288:Ash1l	UTSW	3	88965892	start gained	probably benign
R7319:Ash1l	UTSW	3	88981387	missense	probably benign	0.19
R7341:Ash1l	UTSW	3	88981759	missense	possibly damaging	0.93
R7342:Ash1l	UTSW	3	88965997	missense	possibly damaging	0.94
R7454:Ash1l	UTSW	3	88983865	missense	probably benign	0.16
R7677:Ash1l	UTSW	3	89043193	missense	probably damaging	1.00
R7822:Ash1l	UTSW	3	89007264	missense	probably benign
R7857:Ash1l	UTSW	3	88984309	nonsense	probably null
R7889:Ash1l	UTSW	3	88966038	missense	probably benign	0.00
R7898:Ash1l	UTSW	3	88983625	missense	possibly damaging	0.54
R7931:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R7937:Ash1l	UTSW	3	89070317	nonsense	probably null
R7973:Ash1l	UTSW	3	89052857	missense	probably benign
R8119:Ash1l	UTSW	3	89035427	missense	probably damaging	1.00
R8157:Ash1l	UTSW	3	89063707	critical splice donor site	probably null
R8162:Ash1l	UTSW	3	89070246	missense	probably damaging	0.99
R8194:Ash1l	UTSW	3	89052755	missense	probably damaging	1.00
R8306:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R8497:Ash1l	UTSW	3	89007644	missense	probably benign	0.02
R8558:Ash1l	UTSW	3	88984406	missense	probably damaging	0.96
R8744:Ash1l	UTSW	3	89058583	missense	possibly damaging	0.89
R8923:Ash1l	UTSW	3	88985667	missense	possibly damaging	0.51
R8969:Ash1l	UTSW	3	88966291	missense	possibly damaging	0.52
R8970:Ash1l	UTSW	3	89069000	missense	probably benign	0.00
R9002:Ash1l	UTSW	3	88981408	missense	probably benign	0.17
R9023:Ash1l	UTSW	3	88985269	missense	probably damaging	1.00
R9032:Ash1l	UTSW	3	88981987	missense	probably benign	0.19
R9032:Ash1l	UTSW	3	88984222	missense	probably benign	0.00
R9049:Ash1l	UTSW	3	89007364	missense	probably benign
R9085:Ash1l	UTSW	3	88981987	missense	probably benign	0.19
R9085:Ash1l	UTSW	3	88984222	missense	probably benign	0.00
R9130:Ash1l	UTSW	3	89058541	nonsense	probably null
R9149:Ash1l	UTSW	3	89007223	missense	probably benign
R9294:Ash1l	UTSW	3	88982990	missense	possibly damaging	0.90
R9365:Ash1l	UTSW	3	88981900	missense	possibly damaging	0.63
R9450:Ash1l	UTSW	3	89007832	missense	possibly damaging	0.86
R9542:Ash1l	UTSW	3	89043259	missense	probably damaging	1.00
R9558:Ash1l	UTSW	3	88982214	missense	probably benign	0.02
R9572:Ash1l	UTSW	3	89052881	missense	probably damaging	1.00
R9688:Ash1l	UTSW	3	88984717	missense	probably damaging	1.00
R9736:Ash1l	UTSW	3	88984426	missense	probably damaging	1.00
R9765:Ash1l	UTSW	3	89023193	missense	probably damaging	1.00
R9789:Ash1l	UTSW	3	88966066	missense	probably benign
X0017:Ash1l	UTSW	3	88984585	missense	probably benign	0.45
X0019:Ash1l	UTSW	3	89070556	missense	probably damaging	1.00
X0021:Ash1l	UTSW	3	88983204	missense	probably benign	0.10
Z1088:Ash1l	UTSW	3	88982709	missense	probably benign	0.00
Z1176:Ash1l	UTSW	3	89043217	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCCTTCCCCAGTTAGTGAG -3'
(R):5'- AATAGTTGGCAGGAGGTCTCG -3'

Sequencing Primer
(F):5'- CCCAGTTAGTGAGTCTCATAGTGAC -3'
(R):5'- ATGGGTGATCCGAATCTCAC -3'

Posted On

2014-06-30