Incidental Mutation 'R0119:Me2'
ID21013
Institutional Source Beutler Lab
Gene Symbol Me2
Ensembl Gene ENSMUSG00000024556
Gene Namemalic enzyme 2, NAD(+)-dependent, mitochondrial
SynonymsD030040L20Rik
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0119 (G1)
Quality Score206
Status Validated (trace)
Chromosome18
Chromosomal Location73770040-73815392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73770673 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 575 (S575P)
Ref Sequence ENSEMBL: ENSMUSP00000025439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025439]
Predicted Effect probably benign
Transcript: ENSMUST00000025439
AA Change: S575P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025439
Gene: ENSMUSG00000024556
AA Change: S575P

DomainStartEndE-ValueType
malic 89 270 3.48e-98 SMART
Malic_M 280 535 2.21e-103 SMART
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Me2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Me2 APN 18 73770642 missense probably benign 0.01
IGL00977:Me2 APN 18 73791177 missense probably benign 0.24
IGL01161:Me2 APN 18 73770816 splice site probably benign
IGL02351:Me2 APN 18 73797967 missense probably benign 0.20
IGL02358:Me2 APN 18 73797967 missense probably benign 0.20
IGL02647:Me2 APN 18 73797903 missense probably benign 0.00
IGL03172:Me2 APN 18 73770726 missense probably benign
baako UTSW 18 73797945 missense probably damaging 1.00
first_born UTSW 18 73791128 nonsense probably null
muster UTSW 18 73791844 missense probably benign 0.01
Roundup UTSW 18 73770673 missense probably benign
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0032:Me2 UTSW 18 73794525 missense probably benign
R0136:Me2 UTSW 18 73770673 missense probably benign
R0299:Me2 UTSW 18 73770673 missense probably benign
R0657:Me2 UTSW 18 73770673 missense probably benign
R1597:Me2 UTSW 18 73797945 missense probably damaging 1.00
R1638:Me2 UTSW 18 73773134 missense probably benign 0.03
R1765:Me2 UTSW 18 73791858 missense probably damaging 1.00
R1861:Me2 UTSW 18 73785714 missense probably benign 0.11
R2410:Me2 UTSW 18 73791112 missense probably damaging 0.98
R3422:Me2 UTSW 18 73791194 missense probably damaging 0.99
R3954:Me2 UTSW 18 73781132 missense probably damaging 1.00
R3957:Me2 UTSW 18 73781132 missense probably damaging 1.00
R4052:Me2 UTSW 18 73791085 missense probably benign 0.05
R4207:Me2 UTSW 18 73791085 missense probably benign 0.05
R4208:Me2 UTSW 18 73791085 missense probably benign 0.05
R4694:Me2 UTSW 18 73801859 missense probably benign 0.01
R4962:Me2 UTSW 18 73785776 missense probably damaging 1.00
R5527:Me2 UTSW 18 73791116 missense probably damaging 1.00
R6170:Me2 UTSW 18 73785781 missense probably benign 0.07
R6185:Me2 UTSW 18 73791128 nonsense probably null
R6305:Me2 UTSW 18 73791844 missense probably benign 0.01
R6462:Me2 UTSW 18 73775399 missense probably benign 0.17
R7015:Me2 UTSW 18 73781147 splice site probably null
R7085:Me2 UTSW 18 73781058 missense probably damaging 1.00
R7096:Me2 UTSW 18 73794890 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCACGTTAACAGCGACAGTACCG -3'
(R):5'- TTCATTTCCCAGCTTGCAGAGTACC -3'

Sequencing Primer
(F):5'- ACAGTATAGCCAGCATGTCTGTC -3'
(R):5'- TTGCAGAGTACCTGTACGC -3'
Posted On2013-04-11