Incidental Mutation 'R1909:Vmn2r68'
ID 210159
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms Vmn2r68-ps, EG620697
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 85221518-85237704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85234052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 164 (H164L)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: H164L

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: H164L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,258,036 (GRCm38) I59L probably benign Het
9530053A07Rik T C 7: 28,144,348 (GRCm38) V887A possibly damaging Het
Aarsd1 A C 11: 101,410,231 (GRCm38) probably null Het
Abcc5 A G 16: 20,376,509 (GRCm38) probably null Het
Abcc6 T C 7: 46,020,134 (GRCm38) probably null Het
Adam15 C A 3: 89,345,330 (GRCm38) M317I probably benign Het
Ago3 T C 4: 126,346,737 (GRCm38) T111A probably damaging Het
Amz1 G T 5: 140,752,461 (GRCm38) S492I probably benign Het
Arid1a T C 4: 133,693,761 (GRCm38) N911S unknown Het
Arntl2 A T 6: 146,810,810 (GRCm38) E111V probably benign Het
Ascl2 C A 7: 142,968,163 (GRCm38) A115S probably damaging Het
Ash1l T C 3: 88,984,528 (GRCm38) V1238A probably benign Het
Asxl2 G T 12: 3,474,577 (GRCm38) V202F probably damaging Het
Atp10a A T 7: 58,828,712 (GRCm38) Q1501L probably benign Het
Avpr1a A T 10: 122,452,208 (GRCm38) I374L probably benign Het
Bmx T C X: 164,239,415 (GRCm38) H157R probably benign Het
Camk4 T A 18: 33,158,816 (GRCm38) probably null Het
Ccdc103 G A 11: 102,882,566 (GRCm38) D5N probably benign Het
Ccdc186 A T 19: 56,793,361 (GRCm38) N70K probably damaging Het
Cebpz A T 17: 78,934,907 (GRCm38) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm38) S122R probably benign Het
Cnst T C 1: 179,622,791 (GRCm38) S607P probably damaging Het
Col8a2 C A 4: 126,312,133 (GRCm38) D645E possibly damaging Het
Cpsf4l A T 11: 113,703,378 (GRCm38) probably null Het
Crim1 C T 17: 78,313,127 (GRCm38) T332I probably benign Het
Csmd1 A T 8: 15,906,116 (GRCm38) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,614,058 (GRCm38) S998T probably benign Het
Dab2ip C G 2: 35,718,815 (GRCm38) A587G probably damaging Het
Dach1 C T 14: 97,901,393 (GRCm38) G486D probably damaging Het
Ddx24 T C 12: 103,409,982 (GRCm38) I752V probably damaging Het
Dhx33 A G 11: 70,989,107 (GRCm38) V359A probably benign Het
Dip2c A T 13: 9,533,350 (GRCm38) T123S probably benign Het
Dync1h1 G A 12: 110,662,629 (GRCm38) E4207K probably damaging Het
Eef1b2 G T 1: 63,177,272 (GRCm38) D21Y probably damaging Het
Eif3b T C 5: 140,432,937 (GRCm38) S462P probably damaging Het
Elmod2 G C 8: 83,316,369 (GRCm38) R277G probably benign Het
Epg5 T A 18: 77,959,032 (GRCm38) D555E probably benign Het
Ercc8 A T 13: 108,175,566 (GRCm38) K172* probably null Het
Fat3 T C 9: 15,998,115 (GRCm38) N2197S probably benign Het
Fbf1 A G 11: 116,145,992 (GRCm38) V972A possibly damaging Het
Fes T C 7: 80,386,861 (GRCm38) R113G probably damaging Het
Fzd1 G T 5: 4,757,481 (GRCm38) H34N probably benign Het
Galnt17 T A 5: 131,111,838 (GRCm38) Y147F probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm38) L351P probably damaging Het
Gm10277 TC T 11: 77,786,002 (GRCm38) probably null Het
Gm15448 A T 7: 3,822,919 (GRCm38) I317N probably benign Het
Gm2381 A T 7: 42,819,928 (GRCm38) H257Q probably damaging Het
Gm6904 A T 14: 59,258,613 (GRCm38) S17R probably benign Het
Gm9844 T C 7: 24,862,306 (GRCm38) I10T possibly damaging Het
Hivep1 A T 13: 42,155,646 (GRCm38) K454M probably benign Het
Hmmr T A 11: 40,708,098 (GRCm38) E566D probably damaging Het
Hydin T G 8: 110,587,772 (GRCm38) V4296G probably damaging Het
Il18r1 T A 1: 40,474,914 (GRCm38) D93E probably damaging Het
Iqgap1 T C 7: 80,743,828 (GRCm38) D667G probably benign Het
Lama3 T C 18: 12,581,798 (GRCm38) I3278T probably benign Het
Lrp4 T A 2: 91,498,408 (GRCm38) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm38) probably benign Het
Mga T A 2: 119,926,594 (GRCm38) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,689,800 (GRCm38) M666K probably damaging Het
Ndnf T G 6: 65,703,313 (GRCm38) V192G possibly damaging Het
Nr4a1 T A 15: 101,274,227 (GRCm38) I594N probably damaging Het
Olfr1294 T A 2: 111,538,014 (GRCm38) I92F probably damaging Het
Olfr60 T C 7: 140,345,465 (GRCm38) I175V probably benign Het
Olfr618 A G 7: 103,597,343 (GRCm38) N9S probably benign Het
Olfr635 G A 7: 103,979,790 (GRCm38) W199* probably null Het
Olfr698 T C 7: 106,752,995 (GRCm38) N131S probably benign Het
Paxbp1 T C 16: 91,044,305 (GRCm38) probably benign Het
Pcdhb8 A G 18: 37,355,962 (GRCm38) E231G possibly damaging Het
Pcsk5 A T 19: 17,433,461 (GRCm38) Y1856N probably benign Het
Pde3a T C 6: 141,250,239 (GRCm38) V217A probably benign Het
Pirb A T 7: 3,714,588 (GRCm38) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm38) M335K possibly damaging Het
Pnpla7 T A 2: 24,997,288 (GRCm38) M48K possibly damaging Het
Pomgnt2 A T 9: 121,982,191 (GRCm38) I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 (GRCm38) A239P probably damaging Het
Prkca A T 11: 107,939,612 (GRCm38) D217E possibly damaging Het
Rac3 A C 11: 120,723,337 (GRCm38) I142L probably benign Het
Ralgapb G T 2: 158,444,675 (GRCm38) A347S probably damaging Het
Rbm43 G C 2: 51,925,434 (GRCm38) S258R possibly damaging Het
Rnf182 T A 13: 43,668,423 (GRCm38) V150E probably benign Het
Rsph10b T C 5: 143,985,491 (GRCm38) F409L probably benign Het
Ryr2 A T 13: 11,700,349 (GRCm38) L2778M probably damaging Het
Scn1a T C 2: 66,331,352 (GRCm38) N284S possibly damaging Het
Scyl2 A T 10: 89,640,905 (GRCm38) M786K probably benign Het
Sema4g C A 19: 44,997,622 (GRCm38) R301S probably damaging Het
Senp6 A T 9: 80,113,774 (GRCm38) E245D possibly damaging Het
Setx T C 2: 29,163,009 (GRCm38) V2095A possibly damaging Het
Slc13a2 A T 11: 78,400,142 (GRCm38) M412K possibly damaging Het
Slc25a4 T C 8: 46,209,400 (GRCm38) N74D probably damaging Het
Slc28a1 T A 7: 81,142,035 (GRCm38) F316L probably damaging Het
Slfn8 G A 11: 83,003,621 (GRCm38) Q731* probably null Het
Slitrk4 A G X: 64,272,623 (GRCm38) I146T probably damaging Het
Smg1 A G 7: 118,154,199 (GRCm38) probably benign Het
Smg8 G T 11: 87,080,613 (GRCm38) Y777* probably null Het
Smyd1 T A 6: 71,239,579 (GRCm38) K61N probably benign Het
Sod2 T C 17: 13,015,169 (GRCm38) *223R probably null Het
Sp6 G T 11: 97,021,508 (GRCm38) A16S probably benign Het
Spata31d1a A C 13: 59,702,695 (GRCm38) Y540D probably damaging Het
Spatc1l A G 10: 76,563,917 (GRCm38) D91G probably damaging Het
Spg7 A G 8: 123,080,741 (GRCm38) T419A probably benign Het
St5 G A 7: 109,525,326 (GRCm38) Q686* probably null Het
St8sia4 A G 1: 95,627,573 (GRCm38) I244T probably damaging Het
Tbl2 C T 5: 135,152,991 (GRCm38) R27W probably damaging Het
Tmed4 G A 11: 6,274,694 (GRCm38) P47L probably damaging Het
Tmtc1 T C 6: 148,444,048 (GRCm38) D51G possibly damaging Het
Ttc28 T C 5: 111,284,054 (GRCm38) probably null Het
Unc13d A G 11: 116,070,295 (GRCm38) F412S probably damaging Het
Unc45b A C 11: 82,926,087 (GRCm38) K451T probably damaging Het
Vmn2r16 A G 5: 109,363,987 (GRCm38) M687V probably benign Het
Vps51 A G 19: 6,069,469 (GRCm38) V625A probably benign Het
Wapl T A 14: 34,691,912 (GRCm38) W244R probably damaging Het
Wdr75 C T 1: 45,823,403 (GRCm38) T794I probably benign Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85,237,611 (GRCm38) missense probably benign
IGL01477:Vmn2r68 APN 7 85,233,483 (GRCm38) missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85,222,260 (GRCm38) missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85,222,117 (GRCm38) missense probably benign
IGL01999:Vmn2r68 APN 7 85,222,231 (GRCm38) missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85,221,739 (GRCm38) missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85,221,945 (GRCm38) nonsense probably null
IGL02827:Vmn2r68 APN 7 85,237,592 (GRCm38) missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85,233,387 (GRCm38) missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85,234,441 (GRCm38) missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85,222,240 (GRCm38) nonsense probably null
IGL03166:Vmn2r68 APN 7 85,222,123 (GRCm38) missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85,221,764 (GRCm38) missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85,233,755 (GRCm38) missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85,221,880 (GRCm38) missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85,233,258 (GRCm38) critical splice donor site probably null
R0280:Vmn2r68 UTSW 7 85,233,249 (GRCm38) splice site probably benign
R0281:Vmn2r68 UTSW 7 85,233,258 (GRCm38) critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85,233,249 (GRCm38) splice site probably benign
R0348:Vmn2r68 UTSW 7 85,221,676 (GRCm38) missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85,233,258 (GRCm38) critical splice donor site probably null
R0390:Vmn2r68 UTSW 7 85,233,249 (GRCm38) splice site probably benign
R0722:Vmn2r68 UTSW 7 85,221,586 (GRCm38) missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85,237,504 (GRCm38) splice site probably null
R1136:Vmn2r68 UTSW 7 85,222,341 (GRCm38) missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85,232,492 (GRCm38) missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85,221,738 (GRCm38) missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85,233,366 (GRCm38) missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85,233,678 (GRCm38) missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85,234,659 (GRCm38) nonsense probably null
R1908:Vmn2r68 UTSW 7 85,234,052 (GRCm38) missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85,233,894 (GRCm38) missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85,221,915 (GRCm38) missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R2185:Vmn2r68 UTSW 7 85,233,693 (GRCm38) nonsense probably null
R2188:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R2282:Vmn2r68 UTSW 7 85,221,651 (GRCm38) missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85,234,595 (GRCm38) missense probably benign
R2869:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85,233,626 (GRCm38) missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85,237,667 (GRCm38) missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R3978:Vmn2r68 UTSW 7 85,232,462 (GRCm38) missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R4401:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R4421:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R4478:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R4479:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R4495:Vmn2r68 UTSW 7 85,221,550 (GRCm38) frame shift probably null
R4628:Vmn2r68 UTSW 7 85,234,465 (GRCm38) missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85,221,535 (GRCm38) missense probably benign
R4654:Vmn2r68 UTSW 7 85,233,561 (GRCm38) nonsense probably null
R4793:Vmn2r68 UTSW 7 85,234,440 (GRCm38) missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85,232,414 (GRCm38) missense probably benign
R5021:Vmn2r68 UTSW 7 85,233,734 (GRCm38) missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85,233,868 (GRCm38) missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85,221,991 (GRCm38) missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85,221,877 (GRCm38) missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85,237,559 (GRCm38) missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85,233,718 (GRCm38) missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85,222,075 (GRCm38) missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85,233,770 (GRCm38) missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85,237,604 (GRCm38) missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85,222,245 (GRCm38) missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85,233,840 (GRCm38) missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85,221,765 (GRCm38) missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85,233,707 (GRCm38) missense probably benign
R6699:Vmn2r68 UTSW 7 85,232,375 (GRCm38) missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85,222,252 (GRCm38) missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85,233,834 (GRCm38) missense probably benign
R7374:Vmn2r68 UTSW 7 85,232,399 (GRCm38) missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85,232,379 (GRCm38) missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85,233,908 (GRCm38) missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85,234,514 (GRCm38) missense probably benign
R7979:Vmn2r68 UTSW 7 85,234,417 (GRCm38) critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85,222,214 (GRCm38) nonsense probably null
R8349:Vmn2r68 UTSW 7 85,233,577 (GRCm38) missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85,221,900 (GRCm38) missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85,237,514 (GRCm38) missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85,233,577 (GRCm38) missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 85,234,440 (GRCm38) missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 85,222,113 (GRCm38) missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 85,222,212 (GRCm38) missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 85,233,785 (GRCm38) missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 85,233,549 (GRCm38) missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 85,221,880 (GRCm38) missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85,222,081 (GRCm38) missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85,221,733 (GRCm38) missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85,222,099 (GRCm38) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGGCCATGCTATGCTCAGTTAG -3'
(R):5'- GGCAGCAGCATTGTGAAATG -3'

Sequencing Primer
(F):5'- GCTCAGTTAGGATAGTAATCACAAAC -3'
(R):5'- GCAGCAGCATTGTGAAATGTTATATC -3'
Posted On 2014-06-30