Incidental Mutation 'R1909:Olfr635'
ID210161
Institutional Source Beutler Lab
Gene Symbol Olfr635
Ensembl Gene ENSMUSG00000094520
Gene Nameolfactory receptor 635
SynonymsGA_x6K02T2PBJ9-6713641-6714588, MOR5-2
MMRRC Submission 039928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1909 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103971152-103987540 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 103979790 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 199 (W199*)
Ref Sequence ENSEMBL: ENSMUSP00000148103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098185] [ENSMUST00000209473]
Predicted Effect probably null
Transcript: ENSMUST00000098185
AA Change: W205*
SMART Domains Protein: ENSMUSP00000095788
Gene: ENSMUSG00000094520
AA Change: W205*

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 1.2e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 182 1.3e-9 PFAM
Pfam:7tm_1 49 300 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121874
Predicted Effect probably null
Transcript: ENSMUST00000209473
AA Change: W199*
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
9530053A07Rik T C 7: 28,144,348 V887A possibly damaging Het
Aarsd1 A C 11: 101,410,231 probably null Het
Abcc5 A G 16: 20,376,509 probably null Het
Abcc6 T C 7: 46,020,134 probably null Het
Adam15 C A 3: 89,345,330 M317I probably benign Het
Ago3 T C 4: 126,346,737 T111A probably damaging Het
Amz1 G T 5: 140,752,461 S492I probably benign Het
Arid1a T C 4: 133,693,761 N911S unknown Het
Arntl2 A T 6: 146,810,810 E111V probably benign Het
Ascl2 C A 7: 142,968,163 A115S probably damaging Het
Ash1l T C 3: 88,984,528 V1238A probably benign Het
Asxl2 G T 12: 3,474,577 V202F probably damaging Het
Atp10a A T 7: 58,828,712 Q1501L probably benign Het
Avpr1a A T 10: 122,452,208 I374L probably benign Het
Bmx T C X: 164,239,415 H157R probably benign Het
Camk4 T A 18: 33,158,816 probably null Het
Ccdc103 G A 11: 102,882,566 D5N probably benign Het
Ccdc186 A T 19: 56,793,361 N70K probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cfap206 A C 4: 34,722,714 S122R probably benign Het
Cnst T C 1: 179,622,791 S607P probably damaging Het
Col8a2 C A 4: 126,312,133 D645E possibly damaging Het
Cpsf4l A T 11: 113,703,378 probably null Het
Crim1 C T 17: 78,313,127 T332I probably benign Het
Csmd1 A T 8: 15,906,116 Y3364N probably damaging Het
D5Ertd579e A T 5: 36,614,058 S998T probably benign Het
Dab2ip C G 2: 35,718,815 A587G probably damaging Het
Dach1 C T 14: 97,901,393 G486D probably damaging Het
Ddx24 T C 12: 103,409,982 I752V probably damaging Het
Dhx33 A G 11: 70,989,107 V359A probably benign Het
Dip2c A T 13: 9,533,350 T123S probably benign Het
Dync1h1 G A 12: 110,662,629 E4207K probably damaging Het
Eef1b2 G T 1: 63,177,272 D21Y probably damaging Het
Eif3b T C 5: 140,432,937 S462P probably damaging Het
Elmod2 G C 8: 83,316,369 R277G probably benign Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Ercc8 A T 13: 108,175,566 K172* probably null Het
Fat3 T C 9: 15,998,115 N2197S probably benign Het
Fbf1 A G 11: 116,145,992 V972A possibly damaging Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Fzd1 G T 5: 4,757,481 H34N probably benign Het
Galnt17 T A 5: 131,111,838 Y147F probably benign Het
Gdf6 T C 4: 9,859,971 L351P probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm15448 A T 7: 3,822,919 I317N probably benign Het
Gm2381 A T 7: 42,819,928 H257Q probably damaging Het
Gm6904 A T 14: 59,258,613 S17R probably benign Het
Gm9844 T C 7: 24,862,306 I10T possibly damaging Het
Hivep1 A T 13: 42,155,646 K454M probably benign Het
Hmmr T A 11: 40,708,098 E566D probably damaging Het
Hydin T G 8: 110,587,772 V4296G probably damaging Het
Il18r1 T A 1: 40,474,914 D93E probably damaging Het
Iqgap1 T C 7: 80,743,828 D667G probably benign Het
Lama3 T C 18: 12,581,798 I3278T probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Ncoa7 A T 10: 30,689,800 M666K probably damaging Het
Ndnf T G 6: 65,703,313 V192G possibly damaging Het
Nr4a1 T A 15: 101,274,227 I594N probably damaging Het
Olfr1294 T A 2: 111,538,014 I92F probably damaging Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr618 A G 7: 103,597,343 N9S probably benign Het
Olfr698 T C 7: 106,752,995 N131S probably benign Het
Paxbp1 T C 16: 91,044,305 probably benign Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pcsk5 A T 19: 17,433,461 Y1856N probably benign Het
Pde3a T C 6: 141,250,239 V217A probably benign Het
Pirb A T 7: 3,714,588 D674E probably benign Het
Pnisr T A 4: 21,869,517 M335K possibly damaging Het
Pnpla7 T A 2: 24,997,288 M48K possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkca A T 11: 107,939,612 D217E possibly damaging Het
Rac3 A C 11: 120,723,337 I142L probably benign Het
Ralgapb G T 2: 158,444,675 A347S probably damaging Het
Rbm43 G C 2: 51,925,434 S258R possibly damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Rsph10b T C 5: 143,985,491 F409L probably benign Het
Ryr2 A T 13: 11,700,349 L2778M probably damaging Het
Scn1a T C 2: 66,331,352 N284S possibly damaging Het
Scyl2 A T 10: 89,640,905 M786K probably benign Het
Sema4g C A 19: 44,997,622 R301S probably damaging Het
Senp6 A T 9: 80,113,774 E245D possibly damaging Het
Setx T C 2: 29,163,009 V2095A possibly damaging Het
Slc13a2 A T 11: 78,400,142 M412K possibly damaging Het
Slc25a4 T C 8: 46,209,400 N74D probably damaging Het
Slc28a1 T A 7: 81,142,035 F316L probably damaging Het
Slfn8 G A 11: 83,003,621 Q731* probably null Het
Slitrk4 A G X: 64,272,623 I146T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Smyd1 T A 6: 71,239,579 K61N probably benign Het
Sod2 T C 17: 13,015,169 *223R probably null Het
Sp6 G T 11: 97,021,508 A16S probably benign Het
Spata31d1a A C 13: 59,702,695 Y540D probably damaging Het
Spatc1l A G 10: 76,563,917 D91G probably damaging Het
Spg7 A G 8: 123,080,741 T419A probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
St8sia4 A G 1: 95,627,573 I244T probably damaging Het
Tbl2 C T 5: 135,152,991 R27W probably damaging Het
Tmed4 G A 11: 6,274,694 P47L probably damaging Het
Tmtc1 T C 6: 148,444,048 D51G possibly damaging Het
Ttc28 T C 5: 111,284,054 probably null Het
Unc13d A G 11: 116,070,295 F412S probably damaging Het
Unc45b A C 11: 82,926,087 K451T probably damaging Het
Vmn2r16 A G 5: 109,363,987 M687V probably benign Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vps51 A G 19: 6,069,469 V625A probably benign Het
Wapl T A 14: 34,691,912 W244R probably damaging Het
Wdr75 C T 1: 45,823,403 T794I probably benign Het
Other mutations in Olfr635
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr635 APN 7 103979792 missense probably benign 0.09
IGL01330:Olfr635 APN 7 103980142 utr 3 prime probably benign
IGL01433:Olfr635 APN 7 103979332 missense probably damaging 1.00
FR4304:Olfr635 UTSW 7 103979903 frame shift probably null
FR4340:Olfr635 UTSW 7 103979903 frame shift probably null
FR4342:Olfr635 UTSW 7 103979903 frame shift probably null
R0271:Olfr635 UTSW 7 103979630 missense possibly damaging 0.83
R2212:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R2484:Olfr635 UTSW 7 103979338 missense probably benign
R3412:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R4513:Olfr635 UTSW 7 103979441 missense probably benign 0.03
R4559:Olfr635 UTSW 7 103979560 missense probably damaging 1.00
R5032:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
R5436:Olfr635 UTSW 7 103979266 missense probably benign
R5591:Olfr635 UTSW 7 103980113 missense probably benign 0.00
R5617:Olfr635 UTSW 7 103979714 missense possibly damaging 0.91
R5911:Olfr635 UTSW 7 103979708 missense probably benign
R6249:Olfr635 UTSW 7 103979611 missense possibly damaging 0.85
R6275:Olfr635 UTSW 7 103979974 missense probably damaging 1.00
R6806:Olfr635 UTSW 7 103979564 missense possibly damaging 0.72
R7589:Olfr635 UTSW 7 103979791 missense probably damaging 1.00
R8188:Olfr635 UTSW 7 103979536 missense probably damaging 1.00
R8337:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
RF004:Olfr635 UTSW 7 103979903 frame shift probably null
RF005:Olfr635 UTSW 7 103979561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTATGTGGCCATCTGTCGC -3'
(R):5'- AAGCGGTGAGTCATAGACAC -3'

Sequencing Primer
(F):5'- CCAGTGAGGTCATTGCTAGAATAG -3'
(R):5'- GTGAGTCATAGACACACCAACCATAG -3'
Posted On2014-06-30