Incidental Mutation 'R0121:Gm4847'
ID21017
Institutional Source Beutler Lab
Gene Symbol Gm4847
Ensembl Gene ENSMUSG00000051081
Gene Namepredicted gene 4847
Synonyms
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location166628971-166647693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166642288 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 72 (D72G)
Ref Sequence ENSEMBL: ENSMUSP00000039839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046662]
Predicted Effect probably damaging
Transcript: ENSMUST00000046662
AA Change: D72G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039839
Gene: ENSMUSG00000051081
AA Change: D72G

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 1.4e-235 PFAM
Pfam:Pyr_redox_2 4 241 5.2e-11 PFAM
Pfam:Pyr_redox_3 7 221 6.7e-15 PFAM
Pfam:NAD_binding_8 8 92 1.6e-7 PFAM
Pfam:K_oxygenase 77 333 5.2e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Gm4847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Gm4847 APN 1 166630392 missense possibly damaging 0.55
IGL00943:Gm4847 APN 1 166642353 missense probably benign 0.01
IGL00948:Gm4847 APN 1 166630338 missense probably benign 0.01
IGL01146:Gm4847 APN 1 166634952 missense probably damaging 1.00
IGL01345:Gm4847 APN 1 166634972 missense probably damaging 1.00
IGL01654:Gm4847 APN 1 166638348 missense probably damaging 1.00
IGL01817:Gm4847 APN 1 166634902 missense probably damaging 1.00
IGL02028:Gm4847 APN 1 166642196 missense probably benign 0.23
IGL02031:Gm4847 APN 1 166635009 missense probably damaging 1.00
IGL02412:Gm4847 APN 1 166641738 missense probably damaging 0.98
IGL03278:Gm4847 APN 1 166635036 missense probably benign 0.06
PIT4494001:Gm4847 UTSW 1 166640018 missense probably damaging 1.00
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0492:Gm4847 UTSW 1 166630392 missense probably damaging 1.00
R0973:Gm4847 UTSW 1 166630255 missense probably benign 0.07
R1136:Gm4847 UTSW 1 166630366 missense probably damaging 0.98
R1522:Gm4847 UTSW 1 166641650 missense probably damaging 1.00
R1730:Gm4847 UTSW 1 166638339 missense possibly damaging 0.80
R1818:Gm4847 UTSW 1 166638219 missense probably damaging 1.00
R1819:Gm4847 UTSW 1 166638219 missense probably damaging 1.00
R2145:Gm4847 UTSW 1 166634903 missense probably benign 0.00
R4628:Gm4847 UTSW 1 166630395 missense probably damaging 1.00
R4850:Gm4847 UTSW 1 166642339 missense probably damaging 1.00
R5065:Gm4847 UTSW 1 166634790 missense probably damaging 0.99
R5068:Gm4847 UTSW 1 166638384 missense possibly damaging 0.81
R5493:Gm4847 UTSW 1 166630321 missense probably damaging 1.00
R5500:Gm4847 UTSW 1 166635042 missense probably damaging 1.00
R5990:Gm4847 UTSW 1 166643373 missense probably benign 0.00
R6018:Gm4847 UTSW 1 166643448 missense probably damaging 1.00
R6178:Gm4847 UTSW 1 166642336 missense probably damaging 1.00
R6190:Gm4847 UTSW 1 166630323 missense probably damaging 0.98
R6220:Gm4847 UTSW 1 166634972 missense probably damaging 1.00
R6654:Gm4847 UTSW 1 166630387 missense probably damaging 1.00
R7634:Gm4847 UTSW 1 166632680 missense probably benign
R7796:Gm4847 UTSW 1 166642250 missense probably damaging 0.96
R7856:Gm4847 UTSW 1 166634826 missense probably damaging 1.00
R7877:Gm4847 UTSW 1 166640006 missense possibly damaging 0.48
R8130:Gm4847 UTSW 1 166638348 missense probably damaging 1.00
R8361:Gm4847 UTSW 1 166642270 missense possibly damaging 0.69
R8496:Gm4847 UTSW 1 166642192 missense possibly damaging 0.84
X0018:Gm4847 UTSW 1 166634950 missense probably benign 0.24
X0024:Gm4847 UTSW 1 166632715 missense possibly damaging 0.87
Z1177:Gm4847 UTSW 1 166634773 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGTGGACTTTGCCTTGACCC -3'
(R):5'- GCTCATGGTGTCTCCAGGAGTTAGAAG -3'

Sequencing Primer
(F):5'- TGCCTTGACCCATGTGCAG -3'
(R):5'- GCTATTACAGAGCCAGGATCTATG -3'
Posted On2013-04-11