Incidental Mutation 'R1909:Hydin'
ID 210170
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene Name HYDIN, axonemal central pair apparatus protein
Synonyms 1700034M11Rik, 4930545D19Rik, hy3, hyrh, hy-3
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.757) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 110993609-111336885 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 111314404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 4296 (V4296G)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043141
AA Change: V4296G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: V4296G

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 111,296,434 (GRCm39) missense possibly damaging 0.69
IGL00432:Hydin APN 8 111,327,884 (GRCm39) missense probably damaging 0.98
IGL01025:Hydin APN 8 111,053,033 (GRCm39) missense probably benign 0.38
IGL01140:Hydin APN 8 111,124,694 (GRCm39) missense probably benign 0.14
IGL01317:Hydin APN 8 111,053,078 (GRCm39) missense probably damaging 0.98
IGL01473:Hydin APN 8 111,038,792 (GRCm39) missense probably benign 0.08
IGL01473:Hydin APN 8 111,081,585 (GRCm39) missense probably damaging 1.00
IGL01610:Hydin APN 8 111,284,345 (GRCm39) missense probably benign 0.00
IGL01685:Hydin APN 8 111,081,665 (GRCm39) nonsense probably null
IGL01734:Hydin APN 8 111,217,421 (GRCm39) nonsense probably null
IGL01743:Hydin APN 8 111,319,408 (GRCm39) missense possibly damaging 0.94
IGL01829:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL01919:Hydin APN 8 111,245,806 (GRCm39) missense possibly damaging 0.89
IGL01946:Hydin APN 8 111,217,350 (GRCm39) missense possibly damaging 0.91
IGL01983:Hydin APN 8 111,241,527 (GRCm39) missense probably benign 0.02
IGL02122:Hydin APN 8 111,221,047 (GRCm39) missense possibly damaging 0.86
IGL02140:Hydin APN 8 111,293,570 (GRCm39) missense probably benign
IGL02158:Hydin APN 8 111,336,598 (GRCm39) missense possibly damaging 0.89
IGL02167:Hydin APN 8 111,145,055 (GRCm39) missense possibly damaging 0.96
IGL02171:Hydin APN 8 111,178,590 (GRCm39) nonsense probably null
IGL02185:Hydin APN 8 111,233,108 (GRCm39) missense possibly damaging 0.86
IGL02517:Hydin APN 8 111,293,604 (GRCm39) missense probably benign 0.01
IGL02639:Hydin APN 8 111,265,081 (GRCm39) missense probably benign 0.01
IGL02644:Hydin APN 8 111,265,100 (GRCm39) missense probably damaging 1.00
IGL02652:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL02658:Hydin APN 8 111,139,908 (GRCm39) missense possibly damaging 0.86
IGL02706:Hydin APN 8 111,137,198 (GRCm39) missense probably damaging 0.99
IGL02892:Hydin APN 8 111,325,591 (GRCm39) missense possibly damaging 0.89
IGL02947:Hydin APN 8 111,145,094 (GRCm39) missense probably damaging 0.96
IGL03136:Hydin APN 8 111,145,156 (GRCm39) missense probably benign 0.22
IGL03248:Hydin APN 8 111,321,921 (GRCm39) missense probably damaging 0.97
IGL03251:Hydin APN 8 111,217,228 (GRCm39) missense probably damaging 1.00
IGL03350:Hydin APN 8 111,038,856 (GRCm39) missense possibly damaging 0.86
IGL03366:Hydin APN 8 110,993,995 (GRCm39) missense unknown
IGL03404:Hydin APN 8 111,296,409 (GRCm39) missense probably benign 0.06
Franz_joseph UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
jahreszeiten UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
maria UTSW 8 111,235,759 (GRCm39) splice site probably benign
schoepfung UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
surprise UTSW 8 111,254,648 (GRCm39) missense probably benign
teresa UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
BB001:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB004:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
BB011:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB014:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
P0005:Hydin UTSW 8 111,220,921 (GRCm39) critical splice acceptor site probably null
R0099:Hydin UTSW 8 111,316,193 (GRCm39) missense probably damaging 1.00
R0125:Hydin UTSW 8 111,189,163 (GRCm39) missense probably benign 0.12
R0157:Hydin UTSW 8 111,026,642 (GRCm39) missense possibly damaging 0.86
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0255:Hydin UTSW 8 111,291,650 (GRCm39) missense probably benign 0.00
R0352:Hydin UTSW 8 111,296,533 (GRCm39) critical splice donor site probably null
R0379:Hydin UTSW 8 111,235,759 (GRCm39) splice site probably benign
R0468:Hydin UTSW 8 111,139,855 (GRCm39) missense possibly damaging 0.96
R0477:Hydin UTSW 8 111,145,130 (GRCm39) missense probably damaging 1.00
R0479:Hydin UTSW 8 111,325,720 (GRCm39) missense probably damaging 1.00
R0539:Hydin UTSW 8 111,249,704 (GRCm39) missense probably benign
R0550:Hydin UTSW 8 111,314,407 (GRCm39) missense probably benign 0.01
R0571:Hydin UTSW 8 111,240,735 (GRCm39) splice site probably null
R0606:Hydin UTSW 8 111,276,430 (GRCm39) splice site probably benign
R0789:Hydin UTSW 8 111,293,603 (GRCm39) missense possibly damaging 0.53
R0849:Hydin UTSW 8 111,325,616 (GRCm39) missense probably damaging 1.00
R0946:Hydin UTSW 8 111,257,685 (GRCm39) missense probably benign 0.25
R1201:Hydin UTSW 8 111,296,487 (GRCm39) missense probably benign 0.01
R1375:Hydin UTSW 8 111,232,854 (GRCm39) critical splice donor site probably null
R1385:Hydin UTSW 8 111,249,836 (GRCm39) missense probably benign 0.40
R1411:Hydin UTSW 8 111,301,663 (GRCm39) missense probably benign 0.04
R1437:Hydin UTSW 8 111,308,617 (GRCm39) nonsense probably null
R1447:Hydin UTSW 8 111,249,798 (GRCm39) missense probably damaging 1.00
R1448:Hydin UTSW 8 111,173,217 (GRCm39) missense probably benign 0.27
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1523:Hydin UTSW 8 111,259,903 (GRCm39) missense probably benign 0.05
R1544:Hydin UTSW 8 111,301,486 (GRCm39) missense probably benign 0.30
R1581:Hydin UTSW 8 111,137,092 (GRCm39) missense probably benign
R1584:Hydin UTSW 8 111,307,447 (GRCm39) missense probably benign 0.27
R1598:Hydin UTSW 8 111,137,306 (GRCm39) missense possibly damaging 0.96
R1633:Hydin UTSW 8 111,233,614 (GRCm39) missense probably benign 0.10
R1777:Hydin UTSW 8 111,316,203 (GRCm39) missense probably benign 0.14
R1817:Hydin UTSW 8 111,259,459 (GRCm39) missense probably benign 0.00
R1828:Hydin UTSW 8 111,237,526 (GRCm39) missense probably benign 0.03
R1837:Hydin UTSW 8 111,296,257 (GRCm39) missense probably benign 0.20
R1848:Hydin UTSW 8 111,296,440 (GRCm39) missense probably benign 0.19
R1869:Hydin UTSW 8 111,227,337 (GRCm39) missense possibly damaging 0.94
R1928:Hydin UTSW 8 111,229,579 (GRCm39) missense possibly damaging 0.93
R1950:Hydin UTSW 8 111,336,619 (GRCm39) missense possibly damaging 0.64
R2095:Hydin UTSW 8 111,189,289 (GRCm39) missense probably damaging 0.96
R2172:Hydin UTSW 8 111,308,681 (GRCm39) missense probably benign 0.42
R2217:Hydin UTSW 8 111,145,138 (GRCm39) missense probably benign
R2248:Hydin UTSW 8 111,304,835 (GRCm39) missense probably benign 0.09
R2272:Hydin UTSW 8 111,035,764 (GRCm39) missense probably benign 0.01
R2294:Hydin UTSW 8 111,026,591 (GRCm39) missense probably damaging 0.99
R2315:Hydin UTSW 8 111,124,676 (GRCm39) missense probably benign 0.01
R2330:Hydin UTSW 8 111,291,641 (GRCm39) missense probably benign 0.01
R2374:Hydin UTSW 8 111,291,780 (GRCm39) missense probably damaging 1.00
R2446:Hydin UTSW 8 111,314,347 (GRCm39) missense possibly damaging 0.82
R2484:Hydin UTSW 8 111,239,747 (GRCm39) missense possibly damaging 0.76
R2698:Hydin UTSW 8 111,336,561 (GRCm39) missense possibly damaging 0.70
R2843:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2844:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2846:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2882:Hydin UTSW 8 111,293,555 (GRCm39) missense possibly damaging 0.92
R2937:Hydin UTSW 8 111,130,927 (GRCm39) missense possibly damaging 0.88
R3031:Hydin UTSW 8 111,329,848 (GRCm39) missense possibly damaging 0.83
R3038:Hydin UTSW 8 111,309,321 (GRCm39) missense probably damaging 1.00
R3121:Hydin UTSW 8 111,233,138 (GRCm39) missense probably benign
R3157:Hydin UTSW 8 110,994,005 (GRCm39) missense unknown
R3547:Hydin UTSW 8 111,308,699 (GRCm39) missense possibly damaging 0.85
R3696:Hydin UTSW 8 111,329,911 (GRCm39) missense probably damaging 1.00
R3850:Hydin UTSW 8 111,290,561 (GRCm39) missense probably damaging 0.99
R3896:Hydin UTSW 8 111,235,711 (GRCm39) missense possibly damaging 0.93
R3983:Hydin UTSW 8 111,118,957 (GRCm39) missense probably damaging 1.00
R4031:Hydin UTSW 8 111,336,679 (GRCm39) missense probably benign 0.30
R4072:Hydin UTSW 8 111,231,888 (GRCm39) missense possibly damaging 0.68
R4095:Hydin UTSW 8 111,268,179 (GRCm39) missense probably damaging 0.98
R4176:Hydin UTSW 8 111,320,452 (GRCm39) missense probably benign 0.00
R4213:Hydin UTSW 8 111,183,139 (GRCm39) missense possibly damaging 0.91
R4412:Hydin UTSW 8 111,142,368 (GRCm39) missense probably damaging 0.99
R4471:Hydin UTSW 8 111,313,764 (GRCm39) missense probably damaging 1.00
R4474:Hydin UTSW 8 111,290,497 (GRCm39) missense probably benign 0.11
R4495:Hydin UTSW 8 111,322,034 (GRCm39) missense probably damaging 0.99
R4508:Hydin UTSW 8 111,245,886 (GRCm39) missense possibly damaging 0.91
R4578:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R4583:Hydin UTSW 8 111,321,857 (GRCm39) missense probably benign 0.36
R4600:Hydin UTSW 8 111,293,582 (GRCm39) missense probably benign 0.04
R4681:Hydin UTSW 8 111,233,103 (GRCm39) missense possibly damaging 0.85
R4685:Hydin UTSW 8 111,189,154 (GRCm39) missense probably damaging 0.99
R4689:Hydin UTSW 8 111,322,046 (GRCm39) missense probably benign 0.18
R4735:Hydin UTSW 8 111,282,264 (GRCm39) critical splice donor site probably null
R4736:Hydin UTSW 8 111,249,840 (GRCm39) missense probably benign 0.02
R4740:Hydin UTSW 8 111,173,071 (GRCm39) missense probably benign 0.06
R4771:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R4777:Hydin UTSW 8 111,137,096 (GRCm39) missense probably damaging 0.98
R4859:Hydin UTSW 8 111,233,126 (GRCm39) missense possibly damaging 0.93
R4911:Hydin UTSW 8 111,322,070 (GRCm39) missense probably benign 0.01
R4964:Hydin UTSW 8 111,217,305 (GRCm39) missense possibly damaging 0.86
R4965:Hydin UTSW 8 111,124,727 (GRCm39) missense probably benign
R4989:Hydin UTSW 8 111,290,554 (GRCm39) missense possibly damaging 0.84
R4995:Hydin UTSW 8 111,296,274 (GRCm39) missense probably damaging 0.97
R5059:Hydin UTSW 8 111,232,401 (GRCm39) missense probably damaging 0.96
R5071:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5073:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5092:Hydin UTSW 8 111,309,300 (GRCm39) missense probably benign 0.16
R5156:Hydin UTSW 8 111,336,333 (GRCm39) missense probably benign 0.00
R5166:Hydin UTSW 8 111,249,774 (GRCm39) missense possibly damaging 0.89
R5189:Hydin UTSW 8 111,139,843 (GRCm39) critical splice acceptor site probably null
R5243:Hydin UTSW 8 111,232,380 (GRCm39) missense possibly damaging 0.92
R5244:Hydin UTSW 8 111,259,451 (GRCm39) missense possibly damaging 0.77
R5256:Hydin UTSW 8 111,313,855 (GRCm39) missense possibly damaging 0.92
R5266:Hydin UTSW 8 111,061,416 (GRCm39) missense possibly damaging 0.87
R5283:Hydin UTSW 8 111,178,612 (GRCm39) missense possibly damaging 0.96
R5343:Hydin UTSW 8 111,212,051 (GRCm39) missense probably benign 0.40
R5359:Hydin UTSW 8 111,265,004 (GRCm39) missense probably benign 0.00
R5390:Hydin UTSW 8 111,322,099 (GRCm39) missense probably benign
R5394:Hydin UTSW 8 111,266,474 (GRCm39) splice site probably null
R5441:Hydin UTSW 8 111,291,741 (GRCm39) missense possibly damaging 0.72
R5461:Hydin UTSW 8 111,245,863 (GRCm39) missense probably damaging 0.96
R5662:Hydin UTSW 8 111,307,341 (GRCm39) missense probably benign 0.02
R5695:Hydin UTSW 8 111,261,915 (GRCm39) missense probably benign 0.35
R5732:Hydin UTSW 8 111,178,690 (GRCm39) missense probably benign 0.03
R5774:Hydin UTSW 8 111,298,547 (GRCm39) nonsense probably null
R5780:Hydin UTSW 8 111,312,712 (GRCm39) missense probably damaging 1.00
R5787:Hydin UTSW 8 111,052,985 (GRCm39) missense probably damaging 0.99
R5802:Hydin UTSW 8 111,178,692 (GRCm39) missense possibly damaging 0.86
R5841:Hydin UTSW 8 111,259,846 (GRCm39) missense possibly damaging 0.76
R5856:Hydin UTSW 8 111,268,474 (GRCm39) missense probably damaging 0.99
R5893:Hydin UTSW 8 111,217,308 (GRCm39) missense probably benign 0.12
R5963:Hydin UTSW 8 111,220,926 (GRCm39) missense possibly damaging 0.93
R6008:Hydin UTSW 8 111,325,717 (GRCm39) missense probably benign 0.02
R6019:Hydin UTSW 8 111,293,252 (GRCm39) missense probably benign
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6133:Hydin UTSW 8 111,327,908 (GRCm39) missense probably benign 0.00
R6135:Hydin UTSW 8 111,189,292 (GRCm39) missense possibly damaging 0.85
R6157:Hydin UTSW 8 111,254,648 (GRCm39) missense probably benign
R6209:Hydin UTSW 8 111,320,434 (GRCm39) missense probably benign 0.05
R6238:Hydin UTSW 8 111,118,743 (GRCm39) splice site probably null
R6293:Hydin UTSW 8 111,324,543 (GRCm39) missense possibly damaging 0.83
R6340:Hydin UTSW 8 111,081,574 (GRCm39) splice site probably null
R6349:Hydin UTSW 8 111,145,091 (GRCm39) nonsense probably null
R6357:Hydin UTSW 8 111,268,289 (GRCm39) missense possibly damaging 0.86
R6385:Hydin UTSW 8 111,038,856 (GRCm39) missense possibly damaging 0.86
R6396:Hydin UTSW 8 111,233,521 (GRCm39) missense probably damaging 0.96
R6466:Hydin UTSW 8 111,233,600 (GRCm39) missense possibly damaging 0.85
R6648:Hydin UTSW 8 111,252,299 (GRCm39) splice site probably null
R6671:Hydin UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
R6695:Hydin UTSW 8 111,053,092 (GRCm39) missense probably benign 0.05
R6800:Hydin UTSW 8 111,324,603 (GRCm39) missense probably benign 0.09
R6841:Hydin UTSW 8 111,265,007 (GRCm39) missense probably benign 0.09
R6867:Hydin UTSW 8 111,266,434 (GRCm39) missense probably benign 0.08
R6889:Hydin UTSW 8 111,259,488 (GRCm39) missense possibly damaging 0.79
R6895:Hydin UTSW 8 111,038,883 (GRCm39) missense probably benign 0.00
R6940:Hydin UTSW 8 111,217,243 (GRCm39) missense probably damaging 1.00
R6951:Hydin UTSW 8 111,124,757 (GRCm39) missense probably benign
R6980:Hydin UTSW 8 111,139,916 (GRCm39) missense possibly damaging 0.91
R6981:Hydin UTSW 8 111,257,704 (GRCm39) missense possibly damaging 0.89
R7061:Hydin UTSW 8 111,329,920 (GRCm39) missense possibly damaging 0.90
R7085:Hydin UTSW 8 111,329,962 (GRCm39) missense probably benign 0.03
R7086:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R7110:Hydin UTSW 8 111,081,583 (GRCm39) critical splice acceptor site probably null
R7158:Hydin UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
R7163:Hydin UTSW 8 111,329,968 (GRCm39) missense probably benign 0.25
R7209:Hydin UTSW 8 111,216,424 (GRCm39) nonsense probably null
R7244:Hydin UTSW 8 111,276,307 (GRCm39) missense probably damaging 0.98
R7347:Hydin UTSW 8 111,326,994 (GRCm39) missense probably benign 0.06
R7349:Hydin UTSW 8 111,124,803 (GRCm39) splice site probably null
R7359:Hydin UTSW 8 111,232,733 (GRCm39) missense probably damaging 0.98
R7365:Hydin UTSW 8 111,327,905 (GRCm39) missense probably damaging 1.00
R7365:Hydin UTSW 8 111,284,294 (GRCm39) missense probably damaging 0.99
R7436:Hydin UTSW 8 111,310,546 (GRCm39) missense probably damaging 0.96
R7528:Hydin UTSW 8 111,107,204 (GRCm39) nonsense probably null
R7544:Hydin UTSW 8 111,316,157 (GRCm39) missense probably benign 0.35
R7625:Hydin UTSW 8 111,268,476 (GRCm39) missense probably benign 0.01
R7713:Hydin UTSW 8 111,320,444 (GRCm39) missense possibly damaging 0.69
R7763:Hydin UTSW 8 111,232,475 (GRCm39) missense possibly damaging 0.92
R7771:Hydin UTSW 8 111,291,717 (GRCm39) missense probably damaging 0.97
R7794:Hydin UTSW 8 111,235,715 (GRCm39) missense probably damaging 1.00
R7833:Hydin UTSW 8 111,316,092 (GRCm39) missense probably damaging 0.99
R7894:Hydin UTSW 8 111,239,642 (GRCm39) missense possibly damaging 0.88
R7899:Hydin UTSW 8 111,314,380 (GRCm39) missense probably benign 0.00
R7908:Hydin UTSW 8 111,237,499 (GRCm39) missense probably benign 0.01
R7912:Hydin UTSW 8 111,282,239 (GRCm39) missense possibly damaging 0.68
R7919:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R7924:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
R7927:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
R7970:Hydin UTSW 8 111,035,723 (GRCm39) missense probably damaging 0.99
R7993:Hydin UTSW 8 111,306,264 (GRCm39) missense probably benign
R8011:Hydin UTSW 8 111,310,541 (GRCm39) missense probably damaging 1.00
R8041:Hydin UTSW 8 111,301,626 (GRCm39) missense probably benign 0.02
R8080:Hydin UTSW 8 111,261,863 (GRCm39) missense probably benign 0.32
R8081:Hydin UTSW 8 111,092,101 (GRCm39) missense possibly damaging 0.93
R8095:Hydin UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
R8157:Hydin UTSW 8 111,178,668 (GRCm39) missense probably benign 0.33
R8186:Hydin UTSW 8 111,336,277 (GRCm39) missense probably benign 0.14
R8205:Hydin UTSW 8 111,319,270 (GRCm39) missense possibly damaging 0.57
R8263:Hydin UTSW 8 111,178,705 (GRCm39) missense probably benign 0.00
R8288:Hydin UTSW 8 111,233,661 (GRCm39) missense probably damaging 0.96
R8298:Hydin UTSW 8 111,327,015 (GRCm39) missense probably damaging 1.00
R8309:Hydin UTSW 8 111,334,534 (GRCm39) missense probably benign 0.18
R8348:Hydin UTSW 8 111,329,878 (GRCm39) missense possibly damaging 0.68
R8356:Hydin UTSW 8 111,259,756 (GRCm39) missense possibly damaging 0.67
R8406:Hydin UTSW 8 111,336,543 (GRCm39) missense possibly damaging 0.94
R8415:Hydin UTSW 8 111,178,626 (GRCm39) missense probably damaging 1.00
R8417:Hydin UTSW 8 111,296,024 (GRCm39) missense probably benign 0.28
R8432:Hydin UTSW 8 111,324,583 (GRCm39) missense probably benign 0.02
R8437:Hydin UTSW 8 111,189,367 (GRCm39) missense probably damaging 0.96
R8463:Hydin UTSW 8 111,237,553 (GRCm39) missense probably benign 0.22
R8508:Hydin UTSW 8 111,308,650 (GRCm39) missense probably benign 0.00
R8510:Hydin UTSW 8 111,233,202 (GRCm39) missense probably damaging 1.00
R8560:Hydin UTSW 8 111,265,106 (GRCm39) missense probably benign 0.09
R8682:Hydin UTSW 8 111,035,798 (GRCm39) missense probably damaging 0.96
R8697:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R8857:Hydin UTSW 8 111,298,587 (GRCm39) critical splice donor site probably null
R8866:Hydin UTSW 8 111,308,779 (GRCm39) missense possibly damaging 0.89
R8878:Hydin UTSW 8 111,035,720 (GRCm39) missense probably benign 0.12
R8897:Hydin UTSW 8 111,316,112 (GRCm39) missense probably benign
R8987:Hydin UTSW 8 111,239,766 (GRCm39) nonsense probably null
R9072:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9073:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9102:Hydin UTSW 8 111,235,546 (GRCm39) missense probably benign 0.33
R9224:Hydin UTSW 8 111,259,516 (GRCm39) missense probably benign
R9255:Hydin UTSW 8 111,261,972 (GRCm39) missense probably benign 0.23
R9257:Hydin UTSW 8 111,301,648 (GRCm39) missense probably damaging 0.99
R9261:Hydin UTSW 8 110,994,047 (GRCm39) missense unknown
R9273:Hydin UTSW 8 111,233,580 (GRCm39) missense probably damaging 0.98
R9376:Hydin UTSW 8 111,124,695 (GRCm39) missense possibly damaging 0.70
R9380:Hydin UTSW 8 111,290,504 (GRCm39) missense probably benign 0.07
R9386:Hydin UTSW 8 111,314,362 (GRCm39) missense probably benign
R9406:Hydin UTSW 8 111,314,412 (GRCm39) missense probably null 0.96
R9492:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R9513:Hydin UTSW 8 111,322,114 (GRCm39) missense probably damaging 0.99
R9562:Hydin UTSW 8 111,312,786 (GRCm39) missense probably benign 0.11
R9664:Hydin UTSW 8 111,220,965 (GRCm39) missense probably benign 0.01
R9733:Hydin UTSW 8 111,262,011 (GRCm39) missense probably benign
R9753:Hydin UTSW 8 111,217,398 (GRCm39) missense possibly damaging 0.85
X0063:Hydin UTSW 8 111,277,951 (GRCm39) missense probably damaging 1.00
Z1088:Hydin UTSW 8 111,319,423 (GRCm39) frame shift probably null
Z1088:Hydin UTSW 8 111,312,680 (GRCm39) missense probably benign 0.00
Z1088:Hydin UTSW 8 111,026,605 (GRCm39) missense probably benign 0.12
Z1176:Hydin UTSW 8 111,268,232 (GRCm39) missense possibly damaging 0.65
Z1177:Hydin UTSW 8 111,313,774 (GRCm39) frame shift probably null
Z1177:Hydin UTSW 8 111,176,864 (GRCm39) missense possibly damaging 0.47
Z1177:Hydin UTSW 8 111,107,242 (GRCm39) missense probably damaging 1.00
Z1177:Hydin UTSW 8 111,336,621 (GRCm39) missense probably benign 0.10
Z1188:Hydin UTSW 8 111,142,419 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCCCAATGAATATCTCTCCCTAGAC -3'
(R):5'- ACCTGAGGGCCATTTCCAAG -3'

Sequencing Primer
(F):5'- CAGTTTCATCAACACGGG -3'
(R):5'- AGGCAACCACACTGTTGG -3'
Posted On 2014-06-30