Incidental Mutation 'R1909:Scyl2'
ID 210179
Institutional Source Beutler Lab
Gene Symbol Scyl2
Ensembl Gene ENSMUSG00000069539
Gene Name SCY1-like 2 (S. cerevisiae)
Synonyms D10Ertd802e, CVAK104
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.212) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 89474583-89522147 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89476767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 786 (M786K)
Ref Sequence ENSEMBL: ENSMUSP00000133992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252]
AlphaFold Q8CFE4
Predicted Effect probably benign
Transcript: ENSMUST00000092227
AA Change: M785K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: M785K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 9.7e-15 PFAM
Pfam:Pkinase 32 327 4.6e-24 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 679 704 N/A INTRINSIC
low complexity region 896 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105294
Predicted Effect probably benign
Transcript: ENSMUST00000174252
AA Change: M786K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: M786K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 6.4e-15 PFAM
Pfam:Pkinase 32 327 2.9e-26 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 897 922 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Scyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Scyl2 APN 10 89,493,671 (GRCm39) critical splice donor site probably null
IGL01141:Scyl2 APN 10 89,476,497 (GRCm39) missense probably benign
IGL01597:Scyl2 APN 10 89,488,849 (GRCm39) missense probably damaging 0.99
IGL01713:Scyl2 APN 10 89,490,087 (GRCm39) missense probably damaging 1.00
IGL02349:Scyl2 APN 10 89,493,800 (GRCm39) splice site probably benign
IGL02466:Scyl2 APN 10 89,488,871 (GRCm39) nonsense probably null
IGL02511:Scyl2 APN 10 89,476,681 (GRCm39) missense probably benign
IGL02949:Scyl2 APN 10 89,496,163 (GRCm39) missense possibly damaging 0.82
IGL03087:Scyl2 APN 10 89,488,830 (GRCm39) missense possibly damaging 0.93
IGL03117:Scyl2 APN 10 89,493,729 (GRCm39) missense possibly damaging 0.95
IGL03228:Scyl2 APN 10 89,485,942 (GRCm39) missense probably damaging 1.00
R0019:Scyl2 UTSW 10 89,495,183 (GRCm39) missense probably benign 0.44
R0827:Scyl2 UTSW 10 89,493,727 (GRCm39) missense possibly damaging 0.91
R1394:Scyl2 UTSW 10 89,476,827 (GRCm39) missense possibly damaging 0.59
R1460:Scyl2 UTSW 10 89,493,751 (GRCm39) missense possibly damaging 0.90
R1572:Scyl2 UTSW 10 89,486,818 (GRCm39) missense probably damaging 1.00
R1624:Scyl2 UTSW 10 89,476,598 (GRCm39) missense probably benign 0.19
R3846:Scyl2 UTSW 10 89,476,403 (GRCm39) missense probably damaging 1.00
R4041:Scyl2 UTSW 10 89,485,914 (GRCm39) missense probably damaging 1.00
R4077:Scyl2 UTSW 10 89,476,458 (GRCm39) missense probably benign 0.01
R4079:Scyl2 UTSW 10 89,476,458 (GRCm39) missense probably benign 0.01
R4765:Scyl2 UTSW 10 89,495,160 (GRCm39) missense probably damaging 0.97
R4855:Scyl2 UTSW 10 89,476,325 (GRCm39) utr 3 prime probably benign
R5308:Scyl2 UTSW 10 89,477,869 (GRCm39) missense probably benign 0.01
R5894:Scyl2 UTSW 10 89,476,681 (GRCm39) missense probably benign
R5901:Scyl2 UTSW 10 89,496,124 (GRCm39) missense probably benign 0.03
R6048:Scyl2 UTSW 10 89,481,348 (GRCm39) missense probably benign 0.33
R6249:Scyl2 UTSW 10 89,493,719 (GRCm39) missense possibly damaging 0.93
R6658:Scyl2 UTSW 10 89,476,835 (GRCm39) missense probably benign 0.01
R6827:Scyl2 UTSW 10 89,505,666 (GRCm39) critical splice acceptor site probably null
R6909:Scyl2 UTSW 10 89,481,604 (GRCm39) missense probably benign 0.28
R7027:Scyl2 UTSW 10 89,481,323 (GRCm39) critical splice donor site probably null
R7095:Scyl2 UTSW 10 89,505,549 (GRCm39) missense probably damaging 1.00
R8062:Scyl2 UTSW 10 89,490,022 (GRCm39) missense probably damaging 0.97
R8095:Scyl2 UTSW 10 89,476,965 (GRCm39) missense probably damaging 1.00
R8197:Scyl2 UTSW 10 89,498,228 (GRCm39) missense probably benign 0.33
R8232:Scyl2 UTSW 10 89,498,309 (GRCm39) missense probably damaging 1.00
R8241:Scyl2 UTSW 10 89,489,971 (GRCm39) missense possibly damaging 0.80
R8263:Scyl2 UTSW 10 89,476,525 (GRCm39) missense possibly damaging 0.50
R9020:Scyl2 UTSW 10 89,488,858 (GRCm39) missense probably damaging 1.00
R9748:Scyl2 UTSW 10 89,476,794 (GRCm39) missense probably benign 0.11
Z1177:Scyl2 UTSW 10 89,505,577 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGCCACTGATTTGGTTTCTG -3'
(R):5'- ACCAGCCTTTCTGTTAGCAC -3'

Sequencing Primer
(F):5'- TTCTGAGGGCCAAAGAGATTATTG -3'
(R):5'- AGCACTCCTAAGATTTCTGCTTCAAG -3'
Posted On 2014-06-30