Mutagenetix > Incidental Mutation

Incidental Mutation 'R1909:Scyl2'

210179

Institutional Source

Beutler Lab

Gene Symbol

Scyl2

Ensembl Gene

ENSMUSG00000069539

Gene Name

SCY1-like 2 (S. cerevisiae)

Synonyms

CVAK104, D10Ertd802e

MMRRC Submission

039928-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R1909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89638721-89686285 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89640905 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 786 (M786K)

Ref Sequence

ENSEMBL: ENSMUSP00000133992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252]

AlphaFold

Q8CFE4

Predicted Effect

probably benign
Transcript: ENSMUST00000092227
AA Change: M785K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: M785K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	32	324	9.7e-15	PFAM
Pfam:Pkinase	32	327	4.6e-24	PFAM
low complexity region	356	369	N/A	INTRINSIC
low complexity region	679	704	N/A	INTRINSIC
low complexity region	896	921	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105294

Predicted Effect

probably benign
Transcript: ENSMUST00000174252
AA Change: M786K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: M786K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	32	324	6.4e-15	PFAM
Pfam:Pkinase	32	327	2.9e-26	PFAM
low complexity region	356	369	N/A	INTRINSIC
low complexity region	680	705	N/A	INTRINSIC
low complexity region	897	922	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	A	7: 34,258,036	I59L	probably benign	Het
9530053A07Rik	T	C	7: 28,144,348	V887A	possibly damaging	Het
Aarsd1	A	C	11: 101,410,231		probably null	Het
Abcc5	A	G	16: 20,376,509		probably null	Het
Abcc6	T	C	7: 46,020,134		probably null	Het
Adam15	C	A	3: 89,345,330	M317I	probably benign	Het
Ago3	T	C	4: 126,346,737	T111A	probably damaging	Het
Amz1	G	T	5: 140,752,461	S492I	probably benign	Het
Arid1a	T	C	4: 133,693,761	N911S	unknown	Het
Arntl2	A	T	6: 146,810,810	E111V	probably benign	Het
Ascl2	C	A	7: 142,968,163	A115S	probably damaging	Het
Ash1l	T	C	3: 88,984,528	V1238A	probably benign	Het
Asxl2	G	T	12: 3,474,577	V202F	probably damaging	Het
Atp10a	A	T	7: 58,828,712	Q1501L	probably benign	Het
Avpr1a	A	T	10: 122,452,208	I374L	probably benign	Het
Bmx	T	C	X: 164,239,415	H157R	probably benign	Het
Camk4	T	A	18: 33,158,816		probably null	Het
Ccdc103	G	A	11: 102,882,566	D5N	probably benign	Het
Ccdc186	A	T	19: 56,793,361	N70K	probably damaging	Het
Cebpz	A	T	17: 78,934,907	Y439*	probably null	Het
Cfap206	A	C	4: 34,722,714	S122R	probably benign	Het
Cnst	T	C	1: 179,622,791	S607P	probably damaging	Het
Col8a2	C	A	4: 126,312,133	D645E	possibly damaging	Het
Cpsf4l	A	T	11: 113,703,378		probably null	Het
Crim1	C	T	17: 78,313,127	T332I	probably benign	Het
Csmd1	A	T	8: 15,906,116	Y3364N	probably damaging	Het
D5Ertd579e	A	T	5: 36,614,058	S998T	probably benign	Het
Dab2ip	C	G	2: 35,718,815	A587G	probably damaging	Het
Dach1	C	T	14: 97,901,393	G486D	probably damaging	Het
Ddx24	T	C	12: 103,409,982	I752V	probably damaging	Het
Dhx33	A	G	11: 70,989,107	V359A	probably benign	Het
Dip2c	A	T	13: 9,533,350	T123S	probably benign	Het
Dync1h1	G	A	12: 110,662,629	E4207K	probably damaging	Het
Eef1b2	G	T	1: 63,177,272	D21Y	probably damaging	Het
Eif3b	T	C	5: 140,432,937	S462P	probably damaging	Het
Elmod2	G	C	8: 83,316,369	R277G	probably benign	Het
Epg5	T	A	18: 77,959,032	D555E	probably benign	Het
Ercc8	A	T	13: 108,175,566	K172*	probably null	Het
Fat3	T	C	9: 15,998,115	N2197S	probably benign	Het
Fbf1	A	G	11: 116,145,992	V972A	possibly damaging	Het
Fes	T	C	7: 80,386,861	R113G	probably damaging	Het
Fzd1	G	T	5: 4,757,481	H34N	probably benign	Het
Galnt17	T	A	5: 131,111,838	Y147F	probably benign	Het
Gdf6	T	C	4: 9,859,971	L351P	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm15448	A	T	7: 3,822,919	I317N	probably benign	Het
Gm2381	A	T	7: 42,819,928	H257Q	probably damaging	Het
Gm6904	A	T	14: 59,258,613	S17R	probably benign	Het
Gm9844	T	C	7: 24,862,306	I10T	possibly damaging	Het
Hivep1	A	T	13: 42,155,646	K454M	probably benign	Het
Hmmr	T	A	11: 40,708,098	E566D	probably damaging	Het
Hydin	T	G	8: 110,587,772	V4296G	probably damaging	Het
Il18r1	T	A	1: 40,474,914	D93E	probably damaging	Het
Iqgap1	T	C	7: 80,743,828	D667G	probably benign	Het
Lama3	T	C	18: 12,581,798	I3278T	probably benign	Het
Lrp4	T	A	2: 91,498,408	V1551D	possibly damaging	Het
Mdn1	CGGAGGAGGAGGAGGAG	CGGAGGAGGAGGAG	4: 32,760,839		probably benign	Het
Mga	T	A	2: 119,926,594	H1018Q	possibly damaging	Het
Ncoa7	A	T	10: 30,689,800	M666K	probably damaging	Het
Ndnf	T	G	6: 65,703,313	V192G	possibly damaging	Het
Nr4a1	T	A	15: 101,274,227	I594N	probably damaging	Het
Olfr1294	T	A	2: 111,538,014	I92F	probably damaging	Het
Olfr60	T	C	7: 140,345,465	I175V	probably benign	Het
Olfr618	A	G	7: 103,597,343	N9S	probably benign	Het
Olfr635	G	A	7: 103,979,790	W199*	probably null	Het
Olfr698	T	C	7: 106,752,995	N131S	probably benign	Het
Paxbp1	T	C	16: 91,044,305		probably benign	Het
Pcdhb8	A	G	18: 37,355,962	E231G	possibly damaging	Het
Pcsk5	A	T	19: 17,433,461	Y1856N	probably benign	Het
Pde3a	T	C	6: 141,250,239	V217A	probably benign	Het
Pirb	A	T	7: 3,714,588	D674E	probably benign	Het
Pnisr	T	A	4: 21,869,517	M335K	possibly damaging	Het
Pnpla7	T	A	2: 24,997,288	M48K	possibly damaging	Het
Pomgnt2	A	T	9: 121,982,191	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkca	A	T	11: 107,939,612	D217E	possibly damaging	Het
Rac3	A	C	11: 120,723,337	I142L	probably benign	Het
Ralgapb	G	T	2: 158,444,675	A347S	probably damaging	Het
Rbm43	G	C	2: 51,925,434	S258R	possibly damaging	Het
Rnf182	T	A	13: 43,668,423	V150E	probably benign	Het
Rsph10b	T	C	5: 143,985,491	F409L	probably benign	Het
Ryr2	A	T	13: 11,700,349	L2778M	probably damaging	Het
Scn1a	T	C	2: 66,331,352	N284S	possibly damaging	Het
Sema4g	C	A	19: 44,997,622	R301S	probably damaging	Het
Senp6	A	T	9: 80,113,774	E245D	possibly damaging	Het
Setx	T	C	2: 29,163,009	V2095A	possibly damaging	Het
Slc13a2	A	T	11: 78,400,142	M412K	possibly damaging	Het
Slc25a4	T	C	8: 46,209,400	N74D	probably damaging	Het
Slc28a1	T	A	7: 81,142,035	F316L	probably damaging	Het
Slfn8	G	A	11: 83,003,621	Q731*	probably null	Het
Slitrk4	A	G	X: 64,272,623	I146T	probably damaging	Het
Smg1	A	G	7: 118,154,199		probably benign	Het
Smg8	G	T	11: 87,080,613	Y777*	probably null	Het
Smyd1	T	A	6: 71,239,579	K61N	probably benign	Het
Sod2	T	C	17: 13,015,169	*223R	probably null	Het
Sp6	G	T	11: 97,021,508	A16S	probably benign	Het
Spata31d1a	A	C	13: 59,702,695	Y540D	probably damaging	Het
Spatc1l	A	G	10: 76,563,917	D91G	probably damaging	Het
Spg7	A	G	8: 123,080,741	T419A	probably benign	Het
St5	G	A	7: 109,525,326	Q686*	probably null	Het
St8sia4	A	G	1: 95,627,573	I244T	probably damaging	Het
Tbl2	C	T	5: 135,152,991	R27W	probably damaging	Het
Tmed4	G	A	11: 6,274,694	P47L	probably damaging	Het
Tmtc1	T	C	6: 148,444,048	D51G	possibly damaging	Het
Ttc28	T	C	5: 111,284,054		probably null	Het
Unc13d	A	G	11: 116,070,295	F412S	probably damaging	Het
Unc45b	A	C	11: 82,926,087	K451T	probably damaging	Het
Vmn2r16	A	G	5: 109,363,987	M687V	probably benign	Het
Vmn2r68	T	A	7: 85,234,052	H164L	probably benign	Het
Vps51	A	G	19: 6,069,469	V625A	probably benign	Het
Wapl	T	A	14: 34,691,912	W244R	probably damaging	Het
Wdr75	C	T	1: 45,823,403	T794I	probably benign	Het

Other mutations in Scyl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Scyl2	APN	10	89657809	critical splice donor site	probably null
IGL01141:Scyl2	APN	10	89640635	missense	probably benign
IGL01597:Scyl2	APN	10	89652987	missense	probably damaging	0.99
IGL01713:Scyl2	APN	10	89654225	missense	probably damaging	1.00
IGL02349:Scyl2	APN	10	89657938	splice site	probably benign
IGL02466:Scyl2	APN	10	89653009	nonsense	probably null
IGL02511:Scyl2	APN	10	89640819	missense	probably benign
IGL02949:Scyl2	APN	10	89660301	missense	possibly damaging	0.82
IGL03087:Scyl2	APN	10	89652968	missense	possibly damaging	0.93
IGL03117:Scyl2	APN	10	89657867	missense	possibly damaging	0.95
IGL03228:Scyl2	APN	10	89650080	missense	probably damaging	1.00
R0019:Scyl2	UTSW	10	89659321	missense	probably benign	0.44
R0827:Scyl2	UTSW	10	89657865	missense	possibly damaging	0.91
R1394:Scyl2	UTSW	10	89640965	missense	possibly damaging	0.59
R1460:Scyl2	UTSW	10	89657889	missense	possibly damaging	0.90
R1572:Scyl2	UTSW	10	89650956	missense	probably damaging	1.00
R1624:Scyl2	UTSW	10	89640736	missense	probably benign	0.19
R3846:Scyl2	UTSW	10	89640541	missense	probably damaging	1.00
R4041:Scyl2	UTSW	10	89650052	missense	probably damaging	1.00
R4077:Scyl2	UTSW	10	89640596	missense	probably benign	0.01
R4079:Scyl2	UTSW	10	89640596	missense	probably benign	0.01
R4765:Scyl2	UTSW	10	89659298	missense	probably damaging	0.97
R4855:Scyl2	UTSW	10	89640463	utr 3 prime	probably benign
R5308:Scyl2	UTSW	10	89642007	missense	probably benign	0.01
R5894:Scyl2	UTSW	10	89640819	missense	probably benign
R5901:Scyl2	UTSW	10	89660262	missense	probably benign	0.03
R6048:Scyl2	UTSW	10	89645486	missense	probably benign	0.33
R6249:Scyl2	UTSW	10	89657857	missense	possibly damaging	0.93
R6658:Scyl2	UTSW	10	89640973	missense	probably benign	0.01
R6827:Scyl2	UTSW	10	89669804	critical splice acceptor site	probably null
R6909:Scyl2	UTSW	10	89645742	missense	probably benign	0.28
R7027:Scyl2	UTSW	10	89645461	critical splice donor site	probably null
R7095:Scyl2	UTSW	10	89669687	missense	probably damaging	1.00
R8062:Scyl2	UTSW	10	89654160	missense	probably damaging	0.97
R8095:Scyl2	UTSW	10	89641103	missense	probably damaging	1.00
R8197:Scyl2	UTSW	10	89662366	missense	probably benign	0.33
R8232:Scyl2	UTSW	10	89662447	missense	probably damaging	1.00
R8241:Scyl2	UTSW	10	89654109	missense	possibly damaging	0.80
R8263:Scyl2	UTSW	10	89640663	missense	possibly damaging	0.50
R9020:Scyl2	UTSW	10	89652996	missense	probably damaging	1.00
R9748:Scyl2	UTSW	10	89640932	missense	probably benign	0.11
Z1177:Scyl2	UTSW	10	89669715	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCCACTGATTTGGTTTCTG -3'
(R):5'- ACCAGCCTTTCTGTTAGCAC -3'

Sequencing Primer
(F):5'- TTCTGAGGGCCAAAGAGATTATTG -3'
(R):5'- AGCACTCCTAAGATTTCTGCTTCAAG -3'

Posted On

2014-06-30