Incidental Mutation 'R1909:Unc45b'
ID 210186
Institutional Source Beutler Lab
Gene Symbol Unc45b
Ensembl Gene ENSMUSG00000018845
Gene Name unc-45 myosin chaperone B
Synonyms UNC45, Cmya4, D230041A13Rik
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1909 (G1)
Quality Score 214
Status Not validated
Chromosome 11
Chromosomal Location 82802112-82834284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 82816913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 451 (K451T)
Ref Sequence ENSEMBL: ENSMUSP00000129405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000164945]
AlphaFold Q8CGY6
Predicted Effect probably damaging
Transcript: ENSMUST00000018989
AA Change: K451T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: K451T

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 541 582 7e-7 BLAST
Blast:ARM 661 701 2e-14 BLAST
Blast:ARM 704 746 5e-11 BLAST
Blast:ARM 747 788 1e-20 BLAST
Blast:ARM 789 820 1e-11 BLAST
low complexity region 821 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108160
AA Change: K451T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: K451T

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 271 489 2.2e-52 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156395
Predicted Effect probably damaging
Transcript: ENSMUST00000164945
AA Change: K451T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: K451T

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Unc45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Unc45b APN 11 82,803,219 (GRCm39) critical splice acceptor site probably null
IGL01983:Unc45b APN 11 82,827,687 (GRCm39) missense probably benign
IGL02083:Unc45b APN 11 82,813,745 (GRCm39) missense probably damaging 0.96
IGL02159:Unc45b APN 11 82,831,007 (GRCm39) splice site probably benign
IGL02160:Unc45b APN 11 82,831,007 (GRCm39) splice site probably benign
IGL02165:Unc45b APN 11 82,831,007 (GRCm39) splice site probably benign
IGL02166:Unc45b APN 11 82,831,007 (GRCm39) splice site probably benign
IGL02986:Unc45b APN 11 82,808,005 (GRCm39) missense probably damaging 0.98
fife UTSW 11 82,827,678 (GRCm39) missense probably benign 0.00
R0195:Unc45b UTSW 11 82,828,654 (GRCm39) missense probably damaging 1.00
R0197:Unc45b UTSW 11 82,831,031 (GRCm39) missense possibly damaging 0.78
R0218:Unc45b UTSW 11 82,802,686 (GRCm39) splice site probably benign
R0436:Unc45b UTSW 11 82,820,393 (GRCm39) splice site probably benign
R0569:Unc45b UTSW 11 82,827,638 (GRCm39) splice site probably benign
R0701:Unc45b UTSW 11 82,831,031 (GRCm39) missense possibly damaging 0.78
R0883:Unc45b UTSW 11 82,831,031 (GRCm39) missense possibly damaging 0.78
R1146:Unc45b UTSW 11 82,813,733 (GRCm39) missense probably damaging 0.99
R1146:Unc45b UTSW 11 82,813,733 (GRCm39) missense probably damaging 0.99
R1378:Unc45b UTSW 11 82,827,678 (GRCm39) missense probably benign 0.00
R1446:Unc45b UTSW 11 82,819,496 (GRCm39) missense probably damaging 1.00
R1532:Unc45b UTSW 11 82,827,700 (GRCm39) missense probably benign 0.12
R1559:Unc45b UTSW 11 82,808,672 (GRCm39) missense possibly damaging 0.66
R1582:Unc45b UTSW 11 82,816,771 (GRCm39) missense probably benign 0.30
R1628:Unc45b UTSW 11 82,820,206 (GRCm39) splice site probably null
R1666:Unc45b UTSW 11 82,808,565 (GRCm39) missense probably benign 0.31
R1677:Unc45b UTSW 11 82,802,531 (GRCm39) splice site probably null
R1759:Unc45b UTSW 11 82,820,325 (GRCm39) missense probably benign 0.33
R2067:Unc45b UTSW 11 82,802,515 (GRCm39) missense probably benign 0.01
R2111:Unc45b UTSW 11 82,802,515 (GRCm39) missense probably benign 0.01
R2145:Unc45b UTSW 11 82,808,580 (GRCm39) missense probably benign 0.30
R2258:Unc45b UTSW 11 82,808,625 (GRCm39) missense probably benign 0.01
R2259:Unc45b UTSW 11 82,808,625 (GRCm39) missense probably benign 0.01
R2497:Unc45b UTSW 11 82,827,269 (GRCm39) missense probably damaging 1.00
R2507:Unc45b UTSW 11 82,830,963 (GRCm39) splice site probably null
R4352:Unc45b UTSW 11 82,804,035 (GRCm39) missense probably damaging 0.99
R4569:Unc45b UTSW 11 82,827,315 (GRCm39) critical splice donor site probably null
R4624:Unc45b UTSW 11 82,816,835 (GRCm39) missense probably benign 0.30
R5236:Unc45b UTSW 11 82,805,888 (GRCm39) missense possibly damaging 0.53
R5512:Unc45b UTSW 11 82,805,898 (GRCm39) missense possibly damaging 0.47
R5688:Unc45b UTSW 11 82,813,643 (GRCm39) missense possibly damaging 0.88
R6029:Unc45b UTSW 11 82,804,153 (GRCm39) missense probably damaging 1.00
R6616:Unc45b UTSW 11 82,802,645 (GRCm39) missense probably damaging 1.00
R6857:Unc45b UTSW 11 82,804,038 (GRCm39) missense probably benign 0.00
R6876:Unc45b UTSW 11 82,813,738 (GRCm39) missense probably benign 0.00
R7197:Unc45b UTSW 11 82,831,013 (GRCm39) critical splice acceptor site probably null
R7368:Unc45b UTSW 11 82,833,321 (GRCm39) missense probably benign 0.01
R7531:Unc45b UTSW 11 82,819,838 (GRCm39) missense probably damaging 1.00
R7743:Unc45b UTSW 11 82,813,726 (GRCm39) missense probably damaging 1.00
R8198:Unc45b UTSW 11 82,816,814 (GRCm39) frame shift probably null
R8214:Unc45b UTSW 11 82,824,714 (GRCm39) missense possibly damaging 0.50
R8235:Unc45b UTSW 11 82,810,681 (GRCm39) missense probably benign 0.01
R8916:Unc45b UTSW 11 82,804,038 (GRCm39) missense probably benign 0.00
R9004:Unc45b UTSW 11 82,819,515 (GRCm39) missense probably damaging 1.00
R9521:Unc45b UTSW 11 82,808,586 (GRCm39) missense probably benign 0.09
R9687:Unc45b UTSW 11 82,810,562 (GRCm39) missense probably damaging 1.00
R9757:Unc45b UTSW 11 82,810,558 (GRCm39) missense probably damaging 0.99
R9784:Unc45b UTSW 11 82,816,986 (GRCm39) missense probably damaging 1.00
T0970:Unc45b UTSW 11 82,813,714 (GRCm39) missense probably benign 0.00
Z1176:Unc45b UTSW 11 82,833,541 (GRCm39) missense probably damaging 1.00
Z1176:Unc45b UTSW 11 82,819,480 (GRCm39) critical splice acceptor site probably null
Z1177:Unc45b UTSW 11 82,833,379 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTGATTCTCTTGACCATCCTTG -3'
(R):5'- ACACGCCTCCCTCAAGGATG -3'

Sequencing Primer
(F):5'- GTTTTAGGAGCAAATTTGACCCCCAG -3'
(R):5'- TCCCTCAAGGATGGGCAC -3'
Posted On 2014-06-30