Incidental Mutation 'R1909:Dync1h1'
ID 210200
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Name dynein cytoplasmic 1 heavy chain 1
Synonyms MAP1C, Loa, Dnec1, Dnchc1, dynein heavy chain, retrograde transport, 9930018I23Rik, Swl
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 110567886-110633379 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110629063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 4207 (E4207K)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
AlphaFold no structure available at present
PDB Structure Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018851
AA Change: E4207K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: E4207K

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166323
Predicted Effect probably benign
Transcript: ENSMUST00000167395
SMART Domains Protein: ENSMUSP00000126117
Gene: ENSMUSG00000018707

DomainStartEndE-ValueType
Pfam:MT 1 178 5.3e-18 PFAM
Pfam:AAA_9 154 252 3.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171535
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110,615,538 (GRCm39) missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110,580,541 (GRCm39) missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110,592,041 (GRCm39) splice site probably benign
IGL01324:Dync1h1 APN 12 110,593,299 (GRCm39) missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110,583,126 (GRCm39) splice site probably benign
IGL01371:Dync1h1 APN 12 110,605,285 (GRCm39) missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110,624,562 (GRCm39) missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110,581,374 (GRCm39) missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110,625,364 (GRCm39) missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110,618,630 (GRCm39) critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110,603,558 (GRCm39) missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110,599,254 (GRCm39) missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110,628,993 (GRCm39) missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110,629,436 (GRCm39) missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110,607,322 (GRCm39) missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110,606,644 (GRCm39) missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110,625,666 (GRCm39) nonsense probably null
IGL02643:Dync1h1 APN 12 110,625,706 (GRCm39) unclassified probably benign
IGL03076:Dync1h1 APN 12 110,624,327 (GRCm39) missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110,632,989 (GRCm39) splice site probably null
IGL03293:Dync1h1 APN 12 110,595,168 (GRCm39) missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110,585,644 (GRCm39) missense possibly damaging 0.49
chinashop UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
Gesund UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
gymnast UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
Lightfoot UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
Lissom UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
Strong UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
waters UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110,615,538 (GRCm39) missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110,583,241 (GRCm39) missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110,602,880 (GRCm39) missense probably benign
R0110:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110,585,108 (GRCm39) missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110,598,126 (GRCm39) missense probably benign
R0450:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110,599,222 (GRCm39) missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110,582,930 (GRCm39) missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110,618,181 (GRCm39) unclassified probably benign
R0685:Dync1h1 UTSW 12 110,623,626 (GRCm39) missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110,595,718 (GRCm39) missense probably damaging 0.99
R0747:Dync1h1 UTSW 12 110,578,845 (GRCm39) missense probably benign
R0843:Dync1h1 UTSW 12 110,631,647 (GRCm39) missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110,632,393 (GRCm39) missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110,615,698 (GRCm39) missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110,622,791 (GRCm39) missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110,632,096 (GRCm39) critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110,593,426 (GRCm39) missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110,599,362 (GRCm39) splice site probably benign
R1812:Dync1h1 UTSW 12 110,629,334 (GRCm39) missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110,629,059 (GRCm39) missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110,591,070 (GRCm39) missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110,612,738 (GRCm39) missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110,592,166 (GRCm39) missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110,632,857 (GRCm39) critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110,581,026 (GRCm39) missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110,616,022 (GRCm39) missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110,596,420 (GRCm39) missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110,607,316 (GRCm39) missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110,623,065 (GRCm39) missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110,607,654 (GRCm39) missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110,609,681 (GRCm39) missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110,583,325 (GRCm39) missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110,607,460 (GRCm39) critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110,607,020 (GRCm39) missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110,609,563 (GRCm39) missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3736:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3882:Dync1h1 UTSW 12 110,595,492 (GRCm39) missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110,632,399 (GRCm39) missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110,609,624 (GRCm39) missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110,584,483 (GRCm39) nonsense probably null
R4355:Dync1h1 UTSW 12 110,599,333 (GRCm39) missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110,623,573 (GRCm39) missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110,615,917 (GRCm39) missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110,605,278 (GRCm39) missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110,595,201 (GRCm39) missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110,628,975 (GRCm39) missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110,621,962 (GRCm39) missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4733:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4780:Dync1h1 UTSW 12 110,627,630 (GRCm39) missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110,606,235 (GRCm39) missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110,629,289 (GRCm39) missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110,584,444 (GRCm39) missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110,593,326 (GRCm39) nonsense probably null
R5036:Dync1h1 UTSW 12 110,596,969 (GRCm39) missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110,607,341 (GRCm39) missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110,584,366 (GRCm39) missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110,596,114 (GRCm39) missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110,595,264 (GRCm39) missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110,581,502 (GRCm39) missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110,599,099 (GRCm39) missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110,627,384 (GRCm39) missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110,607,575 (GRCm39) missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110,632,422 (GRCm39) missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110,595,496 (GRCm39) missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110,612,707 (GRCm39) nonsense probably null
R5806:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110,580,654 (GRCm39) critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110,599,212 (GRCm39) missense probably benign
R6113:Dync1h1 UTSW 12 110,586,848 (GRCm39) missense probably benign
R6119:Dync1h1 UTSW 12 110,594,440 (GRCm39) missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110,584,427 (GRCm39) missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110,612,639 (GRCm39) missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110,583,171 (GRCm39) missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110,616,282 (GRCm39) missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110,624,981 (GRCm39) missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110,618,614 (GRCm39) missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110,590,995 (GRCm39) missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110,605,335 (GRCm39) missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110,632,521 (GRCm39) nonsense probably null
R7096:Dync1h1 UTSW 12 110,623,512 (GRCm39) missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110,568,173 (GRCm39) missense probably benign
R7224:Dync1h1 UTSW 12 110,584,196 (GRCm39) missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110,631,183 (GRCm39) critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110,631,596 (GRCm39) missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110,602,076 (GRCm39) missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110,591,036 (GRCm39) missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110,600,654 (GRCm39) missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110,632,109 (GRCm39) missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110,618,011 (GRCm39) missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110,580,541 (GRCm39) missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110,597,059 (GRCm39) missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110,627,327 (GRCm39) missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110,585,080 (GRCm39) missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110,632,200 (GRCm39) missense probably damaging 1.00
R7808:Dync1h1 UTSW 12 110,621,893 (GRCm39) missense possibly damaging 0.53
R7891:Dync1h1 UTSW 12 110,609,590 (GRCm39) missense probably benign 0.02
R7895:Dync1h1 UTSW 12 110,582,891 (GRCm39) missense probably damaging 1.00
R7913:Dync1h1 UTSW 12 110,595,168 (GRCm39) missense probably benign 0.12
R8164:Dync1h1 UTSW 12 110,582,794 (GRCm39) missense possibly damaging 0.91
R8257:Dync1h1 UTSW 12 110,602,908 (GRCm39) missense probably damaging 1.00
R8346:Dync1h1 UTSW 12 110,632,226 (GRCm39) missense probably benign 0.21
R8432:Dync1h1 UTSW 12 110,584,576 (GRCm39) missense probably benign 0.00
R8510:Dync1h1 UTSW 12 110,583,177 (GRCm39) missense possibly damaging 0.94
R8731:Dync1h1 UTSW 12 110,607,018 (GRCm39) missense possibly damaging 0.93
R8739:Dync1h1 UTSW 12 110,581,014 (GRCm39) missense probably damaging 1.00
R8756:Dync1h1 UTSW 12 110,583,261 (GRCm39) missense probably benign 0.06
R8855:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8866:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8885:Dync1h1 UTSW 12 110,583,172 (GRCm39) missense probably damaging 1.00
R8893:Dync1h1 UTSW 12 110,608,477 (GRCm39) missense probably damaging 1.00
R8913:Dync1h1 UTSW 12 110,624,602 (GRCm39) missense probably benign 0.14
R8937:Dync1h1 UTSW 12 110,584,471 (GRCm39) missense probably damaging 1.00
R8958:Dync1h1 UTSW 12 110,586,805 (GRCm39) missense probably benign 0.00
R9000:Dync1h1 UTSW 12 110,606,397 (GRCm39) missense probably benign
R9036:Dync1h1 UTSW 12 110,606,186 (GRCm39) missense probably benign
R9090:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9108:Dync1h1 UTSW 12 110,622,706 (GRCm39) intron probably benign
R9161:Dync1h1 UTSW 12 110,625,023 (GRCm39) missense probably benign 0.01
R9185:Dync1h1 UTSW 12 110,601,937 (GRCm39) missense probably benign 0.33
R9271:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9436:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9478:Dync1h1 UTSW 12 110,625,137 (GRCm39) missense probably benign 0.02
R9547:Dync1h1 UTSW 12 110,624,805 (GRCm39) missense probably damaging 1.00
R9561:Dync1h1 UTSW 12 110,615,533 (GRCm39) missense probably damaging 0.99
R9586:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9609:Dync1h1 UTSW 12 110,607,362 (GRCm39) missense probably benign 0.01
Z1088:Dync1h1 UTSW 12 110,596,351 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,624,951 (GRCm39) nonsense probably null
Z1177:Dync1h1 UTSW 12 110,607,611 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,603,988 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGATCTTTGCTTCTGAAG -3'
(R):5'- CTGGGTTACATGTGTACCCTGG -3'

Sequencing Primer
(F):5'- CAGATCTTTGCTTCTGAAGTAGGATC -3'
(R):5'- TGGAGGGGCCAGCTTTC -3'
Posted On 2014-06-30