Incidental Mutation 'R1909:Hivep1'
ID 210203
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Name human immunodeficiency virus type I enhancer binding protein 1
Synonyms Cryabp1, alphaA-CRYBP1
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.511) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 42205304-42338504 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42309122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 454 (K454M)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148] [ENSMUST00000220525]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000060148
AA Change: K454M

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: K454M

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222491
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42,308,125 (GRCm39) missense probably benign 0.00
IGL00572:Hivep1 APN 13 42,312,347 (GRCm39) missense probably benign 0.00
IGL00820:Hivep1 APN 13 42,337,294 (GRCm39) missense probably benign 0.29
IGL00846:Hivep1 APN 13 42,321,092 (GRCm39) nonsense probably null
IGL01068:Hivep1 APN 13 42,313,460 (GRCm39) missense probably benign 0.00
IGL01431:Hivep1 APN 13 42,311,493 (GRCm39) missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42,312,755 (GRCm39) missense probably benign 0.18
IGL01833:Hivep1 APN 13 42,308,464 (GRCm39) nonsense probably null
IGL02037:Hivep1 APN 13 42,309,553 (GRCm39) missense probably benign 0.00
IGL02375:Hivep1 APN 13 42,309,925 (GRCm39) missense probably benign 0.30
IGL02414:Hivep1 APN 13 42,308,385 (GRCm39) missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42,309,130 (GRCm39) missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42,310,787 (GRCm39) missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42,311,161 (GRCm39) missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42,309,412 (GRCm39) missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42,312,380 (GRCm39) missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42,309,604 (GRCm39) missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42,335,147 (GRCm39) missense
R0067:Hivep1 UTSW 13 42,312,132 (GRCm39) missense probably benign 0.00
R0067:Hivep1 UTSW 13 42,312,132 (GRCm39) missense probably benign 0.00
R0078:Hivep1 UTSW 13 42,309,517 (GRCm39) missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42,308,911 (GRCm39) missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42,309,629 (GRCm39) missense probably benign
R0245:Hivep1 UTSW 13 42,317,766 (GRCm39) missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42,311,855 (GRCm39) missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42,313,232 (GRCm39) missense probably benign 0.16
R0655:Hivep1 UTSW 13 42,321,061 (GRCm39) missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42,308,422 (GRCm39) missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42,310,438 (GRCm39) missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42,310,997 (GRCm39) missense probably benign 0.03
R1256:Hivep1 UTSW 13 42,335,307 (GRCm39) missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42,311,519 (GRCm39) missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42,310,616 (GRCm39) missense probably benign 0.03
R1438:Hivep1 UTSW 13 42,311,596 (GRCm39) missense probably benign 0.00
R1672:Hivep1 UTSW 13 42,313,760 (GRCm39) missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42,311,407 (GRCm39) missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42,337,262 (GRCm39) missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42,337,262 (GRCm39) missense possibly damaging 0.80
R1993:Hivep1 UTSW 13 42,310,969 (GRCm39) missense probably benign 0.00
R2004:Hivep1 UTSW 13 42,313,625 (GRCm39) missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42,313,600 (GRCm39) missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42,337,262 (GRCm39) missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42,309,794 (GRCm39) missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42,317,869 (GRCm39) critical splice donor site probably null
R2085:Hivep1 UTSW 13 42,337,226 (GRCm39) missense probably benign 0.34
R3701:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R3702:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R3716:Hivep1 UTSW 13 42,311,971 (GRCm39) missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42,311,971 (GRCm39) missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R3720:Hivep1 UTSW 13 42,312,077 (GRCm39) missense probably benign 0.01
R3820:Hivep1 UTSW 13 42,337,787 (GRCm39) missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42,337,787 (GRCm39) missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R4379:Hivep1 UTSW 13 42,308,906 (GRCm39) missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42,309,289 (GRCm39) missense probably benign
R4587:Hivep1 UTSW 13 42,309,704 (GRCm39) missense probably benign 0.00
R4604:Hivep1 UTSW 13 42,313,225 (GRCm39) missense probably benign 0.08
R4686:Hivep1 UTSW 13 42,309,326 (GRCm39) missense probably benign 0.00
R4725:Hivep1 UTSW 13 42,316,887 (GRCm39) missense probably benign 0.19
R4924:Hivep1 UTSW 13 42,311,792 (GRCm39) missense probably benign 0.20
R5009:Hivep1 UTSW 13 42,312,229 (GRCm39) missense probably benign 0.06
R5320:Hivep1 UTSW 13 42,313,115 (GRCm39) missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42,317,871 (GRCm39) splice site probably null
R5498:Hivep1 UTSW 13 42,276,634 (GRCm39) critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42,311,804 (GRCm39) missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42,310,126 (GRCm39) missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42,313,593 (GRCm39) missense probably benign
R5635:Hivep1 UTSW 13 42,313,603 (GRCm39) missense probably benign 0.16
R5636:Hivep1 UTSW 13 42,316,932 (GRCm39) missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42,310,088 (GRCm39) missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42,310,694 (GRCm39) missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42,313,664 (GRCm39) missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42,337,934 (GRCm39) missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42,310,583 (GRCm39) missense probably benign 0.20
R6033:Hivep1 UTSW 13 42,310,583 (GRCm39) missense probably benign 0.20
R6037:Hivep1 UTSW 13 42,311,416 (GRCm39) missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42,311,416 (GRCm39) missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42,311,846 (GRCm39) missense probably benign 0.01
R6247:Hivep1 UTSW 13 42,310,966 (GRCm39) missense probably benign
R6343:Hivep1 UTSW 13 42,313,147 (GRCm39) nonsense probably null
R6631:Hivep1 UTSW 13 42,309,956 (GRCm39) missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42,317,760 (GRCm39) missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42,308,203 (GRCm39) missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42,310,557 (GRCm39) missense probably benign 0.00
R6800:Hivep1 UTSW 13 42,310,852 (GRCm39) missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42,309,983 (GRCm39) missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42,336,928 (GRCm39) missense probably benign 0.00
R6993:Hivep1 UTSW 13 42,312,190 (GRCm39) missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42,310,814 (GRCm39) missense probably benign 0.26
R7139:Hivep1 UTSW 13 42,313,430 (GRCm39) missense probably benign 0.28
R7186:Hivep1 UTSW 13 42,309,814 (GRCm39) missense probably benign 0.01
R7227:Hivep1 UTSW 13 42,310,387 (GRCm39) missense probably benign 0.02
R7263:Hivep1 UTSW 13 42,311,668 (GRCm39) missense possibly damaging 0.50
R7438:Hivep1 UTSW 13 42,308,387 (GRCm39) missense probably damaging 0.99
R7490:Hivep1 UTSW 13 42,311,126 (GRCm39) missense probably damaging 1.00
R7583:Hivep1 UTSW 13 42,317,716 (GRCm39) missense probably damaging 1.00
R7708:Hivep1 UTSW 13 42,317,753 (GRCm39) nonsense probably null
R7763:Hivep1 UTSW 13 42,312,937 (GRCm39) missense probably benign 0.12
R7840:Hivep1 UTSW 13 42,308,828 (GRCm39) missense probably benign
R7864:Hivep1 UTSW 13 42,312,290 (GRCm39) missense probably benign 0.02
R7913:Hivep1 UTSW 13 42,309,842 (GRCm39) missense probably benign 0.00
R7934:Hivep1 UTSW 13 42,308,174 (GRCm39) missense probably benign 0.17
R8017:Hivep1 UTSW 13 42,321,098 (GRCm39) missense
R8019:Hivep1 UTSW 13 42,321,098 (GRCm39) missense
R8312:Hivep1 UTSW 13 42,308,653 (GRCm39) missense possibly damaging 0.80
R8336:Hivep1 UTSW 13 42,309,405 (GRCm39) missense probably benign 0.00
R8415:Hivep1 UTSW 13 42,308,905 (GRCm39) missense probably benign 0.20
R8477:Hivep1 UTSW 13 42,337,696 (GRCm39) missense probably benign 0.00
R8868:Hivep1 UTSW 13 42,312,407 (GRCm39) missense possibly damaging 0.82
R9015:Hivep1 UTSW 13 42,311,849 (GRCm39) missense probably benign 0.34
R9185:Hivep1 UTSW 13 42,337,975 (GRCm39) missense possibly damaging 0.86
R9225:Hivep1 UTSW 13 42,337,184 (GRCm39) missense probably damaging 1.00
R9330:Hivep1 UTSW 13 42,317,713 (GRCm39) missense probably damaging 1.00
R9364:Hivep1 UTSW 13 42,308,251 (GRCm39) missense possibly damaging 0.63
R9377:Hivep1 UTSW 13 42,335,403 (GRCm39) missense probably benign 0.13
R9422:Hivep1 UTSW 13 42,313,213 (GRCm39) missense probably benign 0.06
R9451:Hivep1 UTSW 13 42,337,252 (GRCm39) missense probably benign 0.00
R9480:Hivep1 UTSW 13 42,337,058 (GRCm39) missense probably damaging 1.00
R9490:Hivep1 UTSW 13 42,311,518 (GRCm39) missense probably damaging 0.96
R9502:Hivep1 UTSW 13 42,322,779 (GRCm39) missense
R9554:Hivep1 UTSW 13 42,308,251 (GRCm39) missense possibly damaging 0.63
X0060:Hivep1 UTSW 13 42,308,461 (GRCm39) missense probably benign 0.07
X0067:Hivep1 UTSW 13 42,310,193 (GRCm39) missense probably damaging 0.98
Z1177:Hivep1 UTSW 13 42,313,457 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTGCTTCTGTTGTCAGTCAAAG -3'
(R):5'- TGCAGGTCCTTGACACATGG -3'

Sequencing Primer
(F):5'- GCAGTCTCCTTCTTCGAGATCAGAAG -3'
(R):5'- GACACATGGGTTGTTCTGTCTCC -3'
Posted On 2014-06-30