Mutagenetix > Incidental Mutation

Incidental Mutation 'R1909:Sod2'

210218

Institutional Source

Beutler Lab

Gene Symbol

Sod2

Ensembl Gene

ENSMUSG00000006818

Gene Name

superoxide dismutase 2, mitochondrial

Synonyms

MnSOD, manganese superoxide dismutase, manganese SOD, Sod-2

MMRRC Submission

039928-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13007839-13018119 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 13015169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Arginine at position 223 (*223R)

Ref Sequence

ENSEMBL: ENSMUSP00000007012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007012]

AlphaFold

P09671

Predicted Effect

probably null
Transcript: ENSMUST00000007012
AA Change: *223R

SMART Domains

Protein: ENSMUSP00000007012
Gene: ENSMUSG00000006818
AA Change: *223R

Domain	Start	End	E-Value	Type
Pfam:Sod_Fe_N	25	106	1e-34	PFAM
Pfam:Sod_Fe_C	113	216	8.1e-41	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mutations affect mitochondrial function. Null homozygotes die early with cardiomyopathy, tissue lipid accumulation, neurodegeneration, motor problems and/or metabolic acidosis depending on strain background. Heterozygotes show mitochondria and apoptosis defects with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	A	7: 34,258,036	I59L	probably benign	Het
9530053A07Rik	T	C	7: 28,144,348	V887A	possibly damaging	Het
Aarsd1	A	C	11: 101,410,231		probably null	Het
Abcc5	A	G	16: 20,376,509		probably null	Het
Abcc6	T	C	7: 46,020,134		probably null	Het
Adam15	C	A	3: 89,345,330	M317I	probably benign	Het
Ago3	T	C	4: 126,346,737	T111A	probably damaging	Het
Amz1	G	T	5: 140,752,461	S492I	probably benign	Het
Arid1a	T	C	4: 133,693,761	N911S	unknown	Het
Arntl2	A	T	6: 146,810,810	E111V	probably benign	Het
Ascl2	C	A	7: 142,968,163	A115S	probably damaging	Het
Ash1l	T	C	3: 88,984,528	V1238A	probably benign	Het
Asxl2	G	T	12: 3,474,577	V202F	probably damaging	Het
Atp10a	A	T	7: 58,828,712	Q1501L	probably benign	Het
Avpr1a	A	T	10: 122,452,208	I374L	probably benign	Het
Bmx	T	C	X: 164,239,415	H157R	probably benign	Het
Camk4	T	A	18: 33,158,816		probably null	Het
Ccdc103	G	A	11: 102,882,566	D5N	probably benign	Het
Ccdc186	A	T	19: 56,793,361	N70K	probably damaging	Het
Cebpz	A	T	17: 78,934,907	Y439*	probably null	Het
Cfap206	A	C	4: 34,722,714	S122R	probably benign	Het
Cnst	T	C	1: 179,622,791	S607P	probably damaging	Het
Col8a2	C	A	4: 126,312,133	D645E	possibly damaging	Het
Cpsf4l	A	T	11: 113,703,378		probably null	Het
Crim1	C	T	17: 78,313,127	T332I	probably benign	Het
Csmd1	A	T	8: 15,906,116	Y3364N	probably damaging	Het
D5Ertd579e	A	T	5: 36,614,058	S998T	probably benign	Het
Dab2ip	C	G	2: 35,718,815	A587G	probably damaging	Het
Dach1	C	T	14: 97,901,393	G486D	probably damaging	Het
Ddx24	T	C	12: 103,409,982	I752V	probably damaging	Het
Dhx33	A	G	11: 70,989,107	V359A	probably benign	Het
Dip2c	A	T	13: 9,533,350	T123S	probably benign	Het
Dync1h1	G	A	12: 110,662,629	E4207K	probably damaging	Het
Eef1b2	G	T	1: 63,177,272	D21Y	probably damaging	Het
Eif3b	T	C	5: 140,432,937	S462P	probably damaging	Het
Elmod2	G	C	8: 83,316,369	R277G	probably benign	Het
Epg5	T	A	18: 77,959,032	D555E	probably benign	Het
Ercc8	A	T	13: 108,175,566	K172*	probably null	Het
Fat3	T	C	9: 15,998,115	N2197S	probably benign	Het
Fbf1	A	G	11: 116,145,992	V972A	possibly damaging	Het
Fes	T	C	7: 80,386,861	R113G	probably damaging	Het
Fzd1	G	T	5: 4,757,481	H34N	probably benign	Het
Galnt17	T	A	5: 131,111,838	Y147F	probably benign	Het
Gdf6	T	C	4: 9,859,971	L351P	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm15448	A	T	7: 3,822,919	I317N	probably benign	Het
Gm2381	A	T	7: 42,819,928	H257Q	probably damaging	Het
Gm6904	A	T	14: 59,258,613	S17R	probably benign	Het
Gm9844	T	C	7: 24,862,306	I10T	possibly damaging	Het
Hivep1	A	T	13: 42,155,646	K454M	probably benign	Het
Hmmr	T	A	11: 40,708,098	E566D	probably damaging	Het
Hydin	T	G	8: 110,587,772	V4296G	probably damaging	Het
Il18r1	T	A	1: 40,474,914	D93E	probably damaging	Het
Iqgap1	T	C	7: 80,743,828	D667G	probably benign	Het
Lama3	T	C	18: 12,581,798	I3278T	probably benign	Het
Lrp4	T	A	2: 91,498,408	V1551D	possibly damaging	Het
Mdn1	CGGAGGAGGAGGAGGAG	CGGAGGAGGAGGAG	4: 32,760,839		probably benign	Het
Mga	T	A	2: 119,926,594	H1018Q	possibly damaging	Het
Ncoa7	A	T	10: 30,689,800	M666K	probably damaging	Het
Ndnf	T	G	6: 65,703,313	V192G	possibly damaging	Het
Nr4a1	T	A	15: 101,274,227	I594N	probably damaging	Het
Olfr1294	T	A	2: 111,538,014	I92F	probably damaging	Het
Olfr60	T	C	7: 140,345,465	I175V	probably benign	Het
Olfr618	A	G	7: 103,597,343	N9S	probably benign	Het
Olfr635	G	A	7: 103,979,790	W199*	probably null	Het
Olfr698	T	C	7: 106,752,995	N131S	probably benign	Het
Paxbp1	T	C	16: 91,044,305		probably benign	Het
Pcdhb8	A	G	18: 37,355,962	E231G	possibly damaging	Het
Pcsk5	A	T	19: 17,433,461	Y1856N	probably benign	Het
Pde3a	T	C	6: 141,250,239	V217A	probably benign	Het
Pirb	A	T	7: 3,714,588	D674E	probably benign	Het
Pnisr	T	A	4: 21,869,517	M335K	possibly damaging	Het
Pnpla7	T	A	2: 24,997,288	M48K	possibly damaging	Het
Pomgnt2	A	T	9: 121,982,191	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkca	A	T	11: 107,939,612	D217E	possibly damaging	Het
Rac3	A	C	11: 120,723,337	I142L	probably benign	Het
Ralgapb	G	T	2: 158,444,675	A347S	probably damaging	Het
Rbm43	G	C	2: 51,925,434	S258R	possibly damaging	Het
Rnf182	T	A	13: 43,668,423	V150E	probably benign	Het
Rsph10b	T	C	5: 143,985,491	F409L	probably benign	Het
Ryr2	A	T	13: 11,700,349	L2778M	probably damaging	Het
Scn1a	T	C	2: 66,331,352	N284S	possibly damaging	Het
Scyl2	A	T	10: 89,640,905	M786K	probably benign	Het
Sema4g	C	A	19: 44,997,622	R301S	probably damaging	Het
Senp6	A	T	9: 80,113,774	E245D	possibly damaging	Het
Setx	T	C	2: 29,163,009	V2095A	possibly damaging	Het
Slc13a2	A	T	11: 78,400,142	M412K	possibly damaging	Het
Slc25a4	T	C	8: 46,209,400	N74D	probably damaging	Het
Slc28a1	T	A	7: 81,142,035	F316L	probably damaging	Het
Slfn8	G	A	11: 83,003,621	Q731*	probably null	Het
Slitrk4	A	G	X: 64,272,623	I146T	probably damaging	Het
Smg1	A	G	7: 118,154,199		probably benign	Het
Smg8	G	T	11: 87,080,613	Y777*	probably null	Het
Smyd1	T	A	6: 71,239,579	K61N	probably benign	Het
Sp6	G	T	11: 97,021,508	A16S	probably benign	Het
Spata31d1a	A	C	13: 59,702,695	Y540D	probably damaging	Het
Spatc1l	A	G	10: 76,563,917	D91G	probably damaging	Het
Spg7	A	G	8: 123,080,741	T419A	probably benign	Het
St5	G	A	7: 109,525,326	Q686*	probably null	Het
St8sia4	A	G	1: 95,627,573	I244T	probably damaging	Het
Tbl2	C	T	5: 135,152,991	R27W	probably damaging	Het
Tmed4	G	A	11: 6,274,694	P47L	probably damaging	Het
Tmtc1	T	C	6: 148,444,048	D51G	possibly damaging	Het
Ttc28	T	C	5: 111,284,054		probably null	Het
Unc13d	A	G	11: 116,070,295	F412S	probably damaging	Het
Unc45b	A	C	11: 82,926,087	K451T	probably damaging	Het
Vmn2r16	A	G	5: 109,363,987	M687V	probably benign	Het
Vmn2r68	T	A	7: 85,234,052	H164L	probably benign	Het
Vps51	A	G	19: 6,069,469	V625A	probably benign	Het
Wapl	T	A	14: 34,691,912	W244R	probably damaging	Het
Wdr75	C	T	1: 45,823,403	T794I	probably benign	Het

Other mutations in Sod2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01012:Sod2	APN	17	13013577	missense	possibly damaging	0.83
IGL03170:Sod2	APN	17	13008370	missense	probably benign
R0735:Sod2	UTSW	17	13010564	missense	probably damaging	1.00
R1775:Sod2	UTSW	17	13015032	missense	probably damaging	0.96
R4928:Sod2	UTSW	17	13008186	missense	probably benign	0.30
R6083:Sod2	UTSW	17	13008031	start gained	probably benign
R6548:Sod2	UTSW	17	13008363	missense	probably benign	0.01
R6670:Sod2	UTSW	17	13008365	missense	possibly damaging	0.95
R7526:Sod2	UTSW	17	13008031	start gained	probably benign
R8816:Sod2	UTSW	17	13008366	missense	probably benign	0.08
R8929:Sod2	UTSW	17	13015087	missense	probably damaging	1.00
R8931:Sod2	UTSW	17	13008306	missense	probably damaging	1.00
R9767:Sod2	UTSW	17	13008293	missense	probably benign	0.03
Z1088:Sod2	UTSW	17	13013538	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTTTCAGGGGCTCTTTCAG -3'
(R):5'- GCGCTGTTCTCAAATAGTTGCC -3'

Sequencing Primer
(F):5'- ACATGTTTTTGCAGGGATATGC -3'
(R):5'- CCAGTCATAGTGCTGCAA -3'

Posted On

2014-06-30