Mutagenetix > Incidental Mutation

Incidental Mutation 'R1909:Lama3'

210221

Institutional Source

Beutler Lab

Gene Symbol

Lama3

Ensembl Gene

ENSMUSG00000024421

Gene Name

laminin, alpha 3

Synonyms

[a]3B, nicein, 150kDa

MMRRC Submission

039928-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12333819-12583013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12581798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 3278 (I3278T)

Ref Sequence

ENSEMBL: ENSMUSP00000089703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000092070
AA Change: I3278T

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: I3278T

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
LamNT	38	294	1.46e-153	SMART
EGF_Lam	296	350	1.39e-4	SMART
EGF_Lam	353	420	2.66e-10	SMART
EGF_Lam	423	464	3.51e-10	SMART
EGF_Lam	488	530	1.73e-9	SMART
EGF_Lam	533	576	3.81e-11	SMART
EGF_like	579	625	1.82e-1	SMART
EGF_Lam	628	678	5.15e-8	SMART
EGF_Lam	681	725	3.54e-6	SMART
low complexity region	768	781	N/A	INTRINSIC
EGF_Lam	1263	1306	3.15e-12	SMART
EGF_Lam	1309	1350	6.3e-3	SMART
EGF_Lam	1353	1399	1.49e-13	SMART
EGF_Lam	1402	1450	8.18e-11	SMART
LamB	1509	1638	4.34e-55	SMART
Pfam:Laminin_EGF	1647	1681	7.9e-5	PFAM
EGF_Lam	1684	1728	2.66e-10	SMART
EGF_Lam	1731	1781	7.81e-8	SMART
Pfam:Laminin_I	1836	2102	2.7e-93	PFAM
low complexity region	2185	2200	N/A	INTRINSIC
coiled coil region	2211	2238	N/A	INTRINSIC
LamG	2406	2566	1.67e-2	SMART
LamG	2614	2742	1.72e-17	SMART
LamG	2785	2900	3.96e-17	SMART
LamG	3005	3133	1.12e-34	SMART
LamG	3175	3308	3.41e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157717

Predicted Effect

probably benign
Transcript: ENSMUST00000188815
AA Change: I1672T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: I1672T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_Lam	78	122	2.66e-10	SMART
EGF_Lam	125	175	7.81e-8	SMART
Pfam:Laminin_I	230	496	1e-90	PFAM
low complexity region	579	594	N/A	INTRINSIC
coiled coil region	605	632	N/A	INTRINSIC
LamG	800	960	1.67e-2	SMART
LamG	1008	1136	1.72e-17	SMART
LamG	1179	1294	3.96e-17	SMART
LamG	1399	1527	1.12e-34	SMART
LamG	1569	1702	3.41e-30	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	A	7: 34,258,036	I59L	probably benign	Het
9530053A07Rik	T	C	7: 28,144,348	V887A	possibly damaging	Het
Aarsd1	A	C	11: 101,410,231		probably null	Het
Abcc5	A	G	16: 20,376,509		probably null	Het
Abcc6	T	C	7: 46,020,134		probably null	Het
Adam15	C	A	3: 89,345,330	M317I	probably benign	Het
Ago3	T	C	4: 126,346,737	T111A	probably damaging	Het
Amz1	G	T	5: 140,752,461	S492I	probably benign	Het
Arid1a	T	C	4: 133,693,761	N911S	unknown	Het
Arntl2	A	T	6: 146,810,810	E111V	probably benign	Het
Ascl2	C	A	7: 142,968,163	A115S	probably damaging	Het
Ash1l	T	C	3: 88,984,528	V1238A	probably benign	Het
Asxl2	G	T	12: 3,474,577	V202F	probably damaging	Het
Atp10a	A	T	7: 58,828,712	Q1501L	probably benign	Het
Avpr1a	A	T	10: 122,452,208	I374L	probably benign	Het
Bmx	T	C	X: 164,239,415	H157R	probably benign	Het
Camk4	T	A	18: 33,158,816		probably null	Het
Ccdc103	G	A	11: 102,882,566	D5N	probably benign	Het
Ccdc186	A	T	19: 56,793,361	N70K	probably damaging	Het
Cebpz	A	T	17: 78,934,907	Y439*	probably null	Het
Cfap206	A	C	4: 34,722,714	S122R	probably benign	Het
Cnst	T	C	1: 179,622,791	S607P	probably damaging	Het
Col8a2	C	A	4: 126,312,133	D645E	possibly damaging	Het
Cpsf4l	A	T	11: 113,703,378		probably null	Het
Crim1	C	T	17: 78,313,127	T332I	probably benign	Het
Csmd1	A	T	8: 15,906,116	Y3364N	probably damaging	Het
D5Ertd579e	A	T	5: 36,614,058	S998T	probably benign	Het
Dab2ip	C	G	2: 35,718,815	A587G	probably damaging	Het
Dach1	C	T	14: 97,901,393	G486D	probably damaging	Het
Ddx24	T	C	12: 103,409,982	I752V	probably damaging	Het
Dhx33	A	G	11: 70,989,107	V359A	probably benign	Het
Dip2c	A	T	13: 9,533,350	T123S	probably benign	Het
Dync1h1	G	A	12: 110,662,629	E4207K	probably damaging	Het
Eef1b2	G	T	1: 63,177,272	D21Y	probably damaging	Het
Eif3b	T	C	5: 140,432,937	S462P	probably damaging	Het
Elmod2	G	C	8: 83,316,369	R277G	probably benign	Het
Epg5	T	A	18: 77,959,032	D555E	probably benign	Het
Ercc8	A	T	13: 108,175,566	K172*	probably null	Het
Fat3	T	C	9: 15,998,115	N2197S	probably benign	Het
Fbf1	A	G	11: 116,145,992	V972A	possibly damaging	Het
Fes	T	C	7: 80,386,861	R113G	probably damaging	Het
Fzd1	G	T	5: 4,757,481	H34N	probably benign	Het
Galnt17	T	A	5: 131,111,838	Y147F	probably benign	Het
Gdf6	T	C	4: 9,859,971	L351P	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm15448	A	T	7: 3,822,919	I317N	probably benign	Het
Gm2381	A	T	7: 42,819,928	H257Q	probably damaging	Het
Gm6904	A	T	14: 59,258,613	S17R	probably benign	Het
Gm9844	T	C	7: 24,862,306	I10T	possibly damaging	Het
Hivep1	A	T	13: 42,155,646	K454M	probably benign	Het
Hmmr	T	A	11: 40,708,098	E566D	probably damaging	Het
Hydin	T	G	8: 110,587,772	V4296G	probably damaging	Het
Il18r1	T	A	1: 40,474,914	D93E	probably damaging	Het
Iqgap1	T	C	7: 80,743,828	D667G	probably benign	Het
Lrp4	T	A	2: 91,498,408	V1551D	possibly damaging	Het
Mdn1	CGGAGGAGGAGGAGGAG	CGGAGGAGGAGGAG	4: 32,760,839		probably benign	Het
Mga	T	A	2: 119,926,594	H1018Q	possibly damaging	Het
Ncoa7	A	T	10: 30,689,800	M666K	probably damaging	Het
Ndnf	T	G	6: 65,703,313	V192G	possibly damaging	Het
Nr4a1	T	A	15: 101,274,227	I594N	probably damaging	Het
Olfr1294	T	A	2: 111,538,014	I92F	probably damaging	Het
Olfr60	T	C	7: 140,345,465	I175V	probably benign	Het
Olfr618	A	G	7: 103,597,343	N9S	probably benign	Het
Olfr635	G	A	7: 103,979,790	W199*	probably null	Het
Olfr698	T	C	7: 106,752,995	N131S	probably benign	Het
Paxbp1	T	C	16: 91,044,305		probably benign	Het
Pcdhb8	A	G	18: 37,355,962	E231G	possibly damaging	Het
Pcsk5	A	T	19: 17,433,461	Y1856N	probably benign	Het
Pde3a	T	C	6: 141,250,239	V217A	probably benign	Het
Pirb	A	T	7: 3,714,588	D674E	probably benign	Het
Pnisr	T	A	4: 21,869,517	M335K	possibly damaging	Het
Pnpla7	T	A	2: 24,997,288	M48K	possibly damaging	Het
Pomgnt2	A	T	9: 121,982,191	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkca	A	T	11: 107,939,612	D217E	possibly damaging	Het
Rac3	A	C	11: 120,723,337	I142L	probably benign	Het
Ralgapb	G	T	2: 158,444,675	A347S	probably damaging	Het
Rbm43	G	C	2: 51,925,434	S258R	possibly damaging	Het
Rnf182	T	A	13: 43,668,423	V150E	probably benign	Het
Rsph10b	T	C	5: 143,985,491	F409L	probably benign	Het
Ryr2	A	T	13: 11,700,349	L2778M	probably damaging	Het
Scn1a	T	C	2: 66,331,352	N284S	possibly damaging	Het
Scyl2	A	T	10: 89,640,905	M786K	probably benign	Het
Sema4g	C	A	19: 44,997,622	R301S	probably damaging	Het
Senp6	A	T	9: 80,113,774	E245D	possibly damaging	Het
Setx	T	C	2: 29,163,009	V2095A	possibly damaging	Het
Slc13a2	A	T	11: 78,400,142	M412K	possibly damaging	Het
Slc25a4	T	C	8: 46,209,400	N74D	probably damaging	Het
Slc28a1	T	A	7: 81,142,035	F316L	probably damaging	Het
Slfn8	G	A	11: 83,003,621	Q731*	probably null	Het
Slitrk4	A	G	X: 64,272,623	I146T	probably damaging	Het
Smg1	A	G	7: 118,154,199		probably benign	Het
Smg8	G	T	11: 87,080,613	Y777*	probably null	Het
Smyd1	T	A	6: 71,239,579	K61N	probably benign	Het
Sod2	T	C	17: 13,015,169	*223R	probably null	Het
Sp6	G	T	11: 97,021,508	A16S	probably benign	Het
Spata31d1a	A	C	13: 59,702,695	Y540D	probably damaging	Het
Spatc1l	A	G	10: 76,563,917	D91G	probably damaging	Het
Spg7	A	G	8: 123,080,741	T419A	probably benign	Het
St5	G	A	7: 109,525,326	Q686*	probably null	Het
St8sia4	A	G	1: 95,627,573	I244T	probably damaging	Het
Tbl2	C	T	5: 135,152,991	R27W	probably damaging	Het
Tmed4	G	A	11: 6,274,694	P47L	probably damaging	Het
Tmtc1	T	C	6: 148,444,048	D51G	possibly damaging	Het
Ttc28	T	C	5: 111,284,054		probably null	Het
Unc13d	A	G	11: 116,070,295	F412S	probably damaging	Het
Unc45b	A	C	11: 82,926,087	K451T	probably damaging	Het
Vmn2r16	A	G	5: 109,363,987	M687V	probably benign	Het
Vmn2r68	T	A	7: 85,234,052	H164L	probably benign	Het
Vps51	A	G	19: 6,069,469	V625A	probably benign	Het
Wapl	T	A	14: 34,691,912	W244R	probably damaging	Het
Wdr75	C	T	1: 45,823,403	T794I	probably benign	Het

Other mutations in Lama3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Lama3	APN	18	12580292	missense	probably benign
IGL00272:Lama3	APN	18	12491548	missense	probably damaging	1.00
IGL00335:Lama3	APN	18	12449588	splice site	probably benign
IGL00836:Lama3	APN	18	12472228	missense	probably benign	0.01
IGL01017:Lama3	APN	18	12441143	critical splice donor site	probably null
IGL01025:Lama3	APN	18	12481037	missense	probably benign	0.09
IGL01394:Lama3	APN	18	12531926	missense	probably null	0.39
IGL01545:Lama3	APN	18	12441131	missense	probably benign	0.01
IGL01685:Lama3	APN	18	12453880	splice site	probably benign
IGL01863:Lama3	APN	18	12419936	splice site	probably benign
IGL01869:Lama3	APN	18	12524763	missense	possibly damaging	0.94
IGL01894:Lama3	APN	18	12572064	missense	probably benign	0.09
IGL02027:Lama3	APN	18	12516513	missense	probably damaging	1.00
IGL02106:Lama3	APN	18	12468314	missense	probably damaging	0.98
IGL02307:Lama3	APN	18	12581783	missense	probably benign	0.09
IGL02342:Lama3	APN	18	12491476	missense	probably damaging	1.00
IGL02377:Lama3	APN	18	12556750	missense	possibly damaging	0.49
IGL02401:Lama3	APN	18	12557727	missense	probably benign	0.02
IGL02517:Lama3	APN	18	12537858	critical splice donor site	probably null
IGL02644:Lama3	APN	18	12525853	missense	probably benign	0.12
IGL02733:Lama3	APN	18	12578127	missense	probably damaging	0.99
IGL02932:Lama3	APN	18	12528801	missense	probably damaging	1.00
IGL03006:Lama3	APN	18	12468368	splice site	probably benign
IGL03038:Lama3	APN	18	12419250	missense	probably damaging	0.99
IGL03064:Lama3	APN	18	12439349	missense	possibly damaging	0.72
IGL03146:Lama3	APN	18	12527624	missense	possibly damaging	0.66
IGL03233:Lama3	APN	18	12481038	missense	probably damaging	1.00
IGL03255:Lama3	APN	18	12539703	missense	probably damaging	1.00
IGL03369:Lama3	APN	18	12553283	missense	probably benign	0.05
IGL03412:Lama3	APN	18	12419182	missense	probably damaging	0.99
IGL02980:Lama3	UTSW	18	12553231	missense	probably benign	0.01
IGL03014:Lama3	UTSW	18	12539967	missense	possibly damaging	0.95
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0106:Lama3	UTSW	18	12403982	missense	probably damaging	0.96
R0148:Lama3	UTSW	18	12448272	missense	probably damaging	1.00
R0165:Lama3	UTSW	18	12524810	missense	probably damaging	0.99
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0316:Lama3	UTSW	18	12519877	missense	probably benign	0.09
R0325:Lama3	UTSW	18	12482126	missense	probably damaging	1.00
R0365:Lama3	UTSW	18	12507007	missense	probably damaging	0.96
R0390:Lama3	UTSW	18	12407563	missense	probably benign	0.10
R0408:Lama3	UTSW	18	12456837	missense	probably benign
R0449:Lama3	UTSW	18	12500512	splice site	probably null
R0453:Lama3	UTSW	18	12465478	missense	possibly damaging	0.63
R0480:Lama3	UTSW	18	12450424	missense	possibly damaging	0.81
R0536:Lama3	UTSW	18	12525894	missense	probably damaging	1.00
R0545:Lama3	UTSW	18	12561701	missense	possibly damaging	0.90
R0567:Lama3	UTSW	18	12549252	missense	probably benign
R0605:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R0617:Lama3	UTSW	18	12419258	critical splice donor site	probably null
R0629:Lama3	UTSW	18	12419245	missense	possibly damaging	0.79
R0671:Lama3	UTSW	18	12477590	missense	possibly damaging	0.80
R0730:Lama3	UTSW	18	12456850	splice site	probably benign
R1216:Lama3	UTSW	18	12421134	splice site	probably benign
R1356:Lama3	UTSW	18	12500577	unclassified	probably benign
R1386:Lama3	UTSW	18	12477370	missense	probably benign	0.04
R1424:Lama3	UTSW	18	12519991	missense	probably benign	0.13
R1426:Lama3	UTSW	18	12481098	critical splice donor site	probably null
R1437:Lama3	UTSW	18	12549227	missense	possibly damaging	0.46
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1472:Lama3	UTSW	18	12482045	missense	probably benign	0.23
R1557:Lama3	UTSW	18	12513731	splice site	probably benign
R1571:Lama3	UTSW	18	12539717	missense	probably damaging	0.98
R1599:Lama3	UTSW	18	12450400	nonsense	probably null
R1631:Lama3	UTSW	18	12407494	missense	probably damaging	1.00
R1647:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1648:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1719:Lama3	UTSW	18	12479872	critical splice donor site	probably null
R1757:Lama3	UTSW	18	12465499	missense	probably benign	0.10
R1766:Lama3	UTSW	18	12402062	missense	probably damaging	1.00
R1853:Lama3	UTSW	18	12513705	missense	possibly damaging	0.75
R1856:Lama3	UTSW	18	12537781	nonsense	probably null
R1913:Lama3	UTSW	18	12495279	missense	probably benign	0.15
R1975:Lama3	UTSW	18	12453863	missense	probably damaging	1.00
R2014:Lama3	UTSW	18	12524721	splice site	probably benign
R2059:Lama3	UTSW	18	12528333	missense	probably damaging	0.98
R2060:Lama3	UTSW	18	12528726	missense	probably benign	0.30
R2086:Lama3	UTSW	18	12524830	missense	probably benign	0.39
R2115:Lama3	UTSW	18	12402849	missense	possibly damaging	0.94
R2291:Lama3	UTSW	18	12525079	missense	probably damaging	0.98
R2860:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2861:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2862:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R3410:Lama3	UTSW	18	12413858	critical splice donor site	probably null
R3614:Lama3	UTSW	18	12448288	missense	probably benign	0.03
R3696:Lama3	UTSW	18	12439475	splice site	probably benign
R3752:Lama3	UTSW	18	12507029	missense	probably damaging	1.00
R3967:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3968:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3969:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3970:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R4088:Lama3	UTSW	18	12504308	nonsense	probably null
R4118:Lama3	UTSW	18	12450431	missense	probably benign	0.01
R4222:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4223:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4224:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4225:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4367:Lama3	UTSW	18	12513690	missense	probably damaging	1.00
R4404:Lama3	UTSW	18	12582531	missense	probably benign	0.01
R4424:Lama3	UTSW	18	12519872	nonsense	probably null
R4483:Lama3	UTSW	18	12549253	missense	probably benign	0.32
R4484:Lama3	UTSW	18	12481088	missense	probably benign
R4516:Lama3	UTSW	18	12495358	missense	probably damaging	1.00
R4556:Lama3	UTSW	18	12479759	missense	possibly damaging	0.63
R4616:Lama3	UTSW	18	12504397	critical splice donor site	probably null
R4702:Lama3	UTSW	18	12578029	nonsense	probably null
R4704:Lama3	UTSW	18	12553223	missense	probably benign	0.08
R4750:Lama3	UTSW	18	12504359	missense	probably benign	0.25
R4753:Lama3	UTSW	18	12482084	missense	probably damaging	1.00
R4767:Lama3	UTSW	18	12500563	missense	probably benign	0.32
R4777:Lama3	UTSW	18	12413771	missense	probably damaging	1.00
R4782:Lama3	UTSW	18	12411570	nonsense	probably null
R4784:Lama3	UTSW	18	12449544	missense	probably benign	0.20
R4816:Lama3	UTSW	18	12477604	missense	possibly damaging	0.93
R4833:Lama3	UTSW	18	12441131	missense	probably benign	0.01
R4854:Lama3	UTSW	18	12411542	missense	probably benign	0.00
R4863:Lama3	UTSW	18	12498678	intron	probably benign
R4863:Lama3	UTSW	18	12539793	missense	probably damaging	0.99
R4953:Lama3	UTSW	18	12448305	missense	probably damaging	1.00
R4974:Lama3	UTSW	18	12552826	missense	probably damaging	0.98
R4996:Lama3	UTSW	18	12518743	missense	probably benign	0.24
R5049:Lama3	UTSW	18	12582611	missense	probably benign	0.19
R5057:Lama3	UTSW	18	12531948	missense	probably null	0.82
R5090:Lama3	UTSW	18	12542402	missense	possibly damaging	0.94
R5122:Lama3	UTSW	18	12539766	missense	possibly damaging	0.53
R5215:Lama3	UTSW	18	12577900	missense	probably damaging	1.00
R5245:Lama3	UTSW	18	12419893	missense	probably damaging	1.00
R5259:Lama3	UTSW	18	12465508	missense	probably damaging	1.00
R5320:Lama3	UTSW	18	12552855	missense	probably damaging	0.99
R5377:Lama3	UTSW	18	12453746	missense	probably damaging	0.99
R5432:Lama3	UTSW	18	12572066	missense	probably damaging	1.00
R5500:Lama3	UTSW	18	12456764	missense	possibly damaging	0.93
R5534:Lama3	UTSW	18	12553210	missense	probably benign	0.00
R5589:Lama3	UTSW	18	12472220	missense	possibly damaging	0.46
R5604:Lama3	UTSW	18	12439348	missense	probably benign
R5617:Lama3	UTSW	18	12498936	intron	probably benign
R5709:Lama3	UTSW	18	12539799	missense	probably damaging	1.00
R5965:Lama3	UTSW	18	12429887	missense	possibly damaging	0.67
R6042:Lama3	UTSW	18	12574254	missense	probably damaging	1.00
R6065:Lama3	UTSW	18	12469928	missense	possibly damaging	0.53
R6085:Lama3	UTSW	18	12482099	missense	probably benign	0.01
R6212:Lama3	UTSW	18	12513645	missense	probably damaging	1.00
R6268:Lama3	UTSW	18	12524737	missense	probably damaging	0.98
R6276:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R6366:Lama3	UTSW	18	12482137	missense	probably damaging	1.00
R6393:Lama3	UTSW	18	12479756	missense	probably benign	0.44
R6493:Lama3	UTSW	18	12482148	critical splice donor site	probably null
R6505:Lama3	UTSW	18	12495348	missense	probably benign	0.02
R6563:Lama3	UTSW	18	12537766	missense	probably damaging	1.00
R6582:Lama3	UTSW	18	12577840	missense	probably damaging	1.00
R6585:Lama3	UTSW	18	12419257	critical splice donor site	probably null
R6609:Lama3	UTSW	18	12513678	missense	probably damaging	0.99
R6656:Lama3	UTSW	18	12549226	missense	possibly damaging	0.66
R6833:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R6834:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R7019:Lama3	UTSW	18	12528418	missense	probably damaging	0.97
R7026:Lama3	UTSW	18	12516548	missense	probably damaging	0.98
R7088:Lama3	UTSW	18	12582545	missense	possibly damaging	0.90
R7100:Lama3	UTSW	18	12582644	missense	possibly damaging	0.80
R7102:Lama3	UTSW	18	12552813	missense	possibly damaging	0.66
R7103:Lama3	UTSW	18	12531879	missense	probably benign	0.00
R7121:Lama3	UTSW	18	12462782	missense	probably benign	0.06
R7133:Lama3	UTSW	18	12539786	missense	probably benign	0.05
R7150:Lama3	UTSW	18	12468289	missense	probably damaging	1.00
R7158:Lama3	UTSW	18	12456812	missense	probably benign	0.20
R7170:Lama3	UTSW	18	12404076	missense	probably benign	0.26
R7216:Lama3	UTSW	18	12430000	missense	probably damaging	1.00
R7223:Lama3	UTSW	18	12582608	missense	possibly damaging	0.53
R7243:Lama3	UTSW	18	12419845	missense	probably damaging	1.00
R7282:Lama3	UTSW	18	12439392	missense	probably damaging	0.99
R7337:Lama3	UTSW	18	12507040	splice site	probably null
R7442:Lama3	UTSW	18	12472181	critical splice acceptor site	probably null
R7487:Lama3	UTSW	18	12419237	missense	probably benign
R7604:Lama3	UTSW	18	12500493	missense	possibly damaging	0.93
R7609:Lama3	UTSW	18	12531834	critical splice acceptor site	probably null
R7650:Lama3	UTSW	18	12537838	missense	probably benign	0.01
R7894:Lama3	UTSW	18	12462807	missense	probably benign	0.07
R7975:Lama3	UTSW	18	12537739	missense	probably damaging	1.00
R8099:Lama3	UTSW	18	12534063	missense	probably damaging	0.97
R8168:Lama3	UTSW	18	12506942	missense	probably null
R8219:Lama3	UTSW	18	12439360	missense	probably benign	0.07
R8227:Lama3	UTSW	18	12407551	missense	probably benign
R8229:Lama3	UTSW	18	12407551	missense	probably benign
R8298:Lama3	UTSW	18	12525853	missense	probably benign	0.12
R8351:Lama3	UTSW	18	12540613	missense	probably damaging	1.00
R8364:Lama3	UTSW	18	12528347	missense	probably damaging	0.99
R8463:Lama3	UTSW	18	12449839	missense	probably damaging	0.96
R8515:Lama3	UTSW	18	12411631	missense	probably null	0.01
R8784:Lama3	UTSW	18	12421155	missense	probably benign
R8799:Lama3	UTSW	18	12490943	missense	probably damaging	0.96
R8874:Lama3	UTSW	18	12449586	critical splice donor site	probably null
R8938:Lama3	UTSW	18	12556705	missense	probably damaging	1.00
R8967:Lama3	UTSW	18	12532039	missense	possibly damaging	0.46
R9039:Lama3	UTSW	18	12481063	nonsense	probably null
R9126:Lama3	UTSW	18	12450470	missense	probably damaging	1.00
R9200:Lama3	UTSW	18	12472240	missense	probably benign	0.00
R9203:Lama3	UTSW	18	12462812	missense	probably benign	0.04
R9246:Lama3	UTSW	18	12577902	missense	probably damaging	0.99
R9284:Lama3	UTSW	18	12450484	nonsense	probably null
R9553:Lama3	UTSW	18	12429962	missense	probably damaging	1.00
R9716:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R9734:Lama3	UTSW	18	12549263	missense	possibly damaging	0.94
X0019:Lama3	UTSW	18	12582574	missense	possibly damaging	0.94
Z1177:Lama3	UTSW	18	12429879	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGAGCAAGTGCCTTCAAACAG -3'
(R):5'- CCTGAGATGTGCCTAGATGCTG -3'

Sequencing Primer
(F):5'- GTGCCTTCAAACAGTGCCC -3'
(R):5'- CTGTTGGGTTGAGAAGAC -3'

Posted On

2014-06-30