Incidental Mutation 'R1911:Elp4'
ID210238
Institutional Source Beutler Lab
Gene Symbol Elp4
Ensembl Gene ENSMUSG00000027167
Gene Nameelongator acetyltransferase complex subunit 4
SynonymsA330107A17Rik, Paxneb
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location105701027-105904564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105702743 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 419 (H419L)
Ref Sequence ENSEMBL: ENSMUSP00000116575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122965]
Predicted Effect probably damaging
Transcript: ENSMUST00000122965
AA Change: H419L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167
AA Change: H419L

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Meta Mutation Damage Score 0.2551 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dmxl1 T C 18: 49,878,163 I1129T probably benign Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mapk8ip3 A C 17: 24,904,051 D610E probably benign Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Muc5ac T C 7: 141,796,304 F595L probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Nod1 C T 6: 54,944,440 V298M probably damaging Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Zfp644 A G 5: 106,635,271 M1079T possibly damaging Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Other mutations in Elp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Elp4 APN 2 105842366 splice site probably benign
IGL01407:Elp4 APN 2 105792308 missense probably damaging 1.00
IGL02173:Elp4 APN 2 105702743 missense probably damaging 0.96
IGL02370:Elp4 APN 2 105794592 missense probably damaging 1.00
R0125:Elp4 UTSW 2 105792214 critical splice donor site probably null
R0685:Elp4 UTSW 2 105792277 missense possibly damaging 0.94
R0893:Elp4 UTSW 2 105896945 splice site probably benign
R1117:Elp4 UTSW 2 105842311 missense probably benign 0.00
R1496:Elp4 UTSW 2 105832161 missense probably benign 0.31
R1542:Elp4 UTSW 2 105794609 missense probably benign 0.02
R2311:Elp4 UTSW 2 105842332 missense probably benign 0.00
R2997:Elp4 UTSW 2 105814316 missense possibly damaging 0.82
R3079:Elp4 UTSW 2 105809445 missense possibly damaging 0.95
R3683:Elp4 UTSW 2 105702761 missense possibly damaging 0.75
R4747:Elp4 UTSW 2 105794607 missense probably damaging 1.00
R4799:Elp4 UTSW 2 105809267 missense probably damaging 0.99
R5438:Elp4 UTSW 2 105904403 missense probably damaging 1.00
R5635:Elp4 UTSW 2 105814264 critical splice donor site probably null
R6414:Elp4 UTSW 2 105904443 missense possibly damaging 0.94
R7228:Elp4 UTSW 2 105792302 missense probably damaging 1.00
R7381:Elp4 UTSW 2 105792307 missense not run
R7560:Elp4 UTSW 2 105794588 missense probably damaging 1.00
R7671:Elp4 UTSW 2 105904481 missense probably damaging 0.99
R8376:Elp4 UTSW 2 105842308 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCTAAATGTCAAATGGCAG -3'
(R):5'- ATTCTGAGTGTGCGGGAAAG -3'

Sequencing Primer
(F):5'- GCTAAATGTCAAATGGCAGTATTTC -3'
(R):5'- GACTTGTCAGACACAGTG -3'
Posted On2014-06-30