Incidental Mutation 'R1911:Zfp644'
ID210255
Institutional Source Beutler Lab
Gene Symbol Zfp644
Ensembl Gene ENSMUSG00000049606
Gene Namezinc finger protein 644
SynonymsD5Ertd689e, 1110068L01Rik, Zep-2, BM-005
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106616739-106697287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106635271 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1079 (M1079T)
Ref Sequence ENSEMBL: ENSMUSP00000108316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698] [ENSMUST00000122980] [ENSMUST00000124263] [ENSMUST00000127434] [ENSMUST00000135108] [ENSMUST00000137285] [ENSMUST00000155495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045466
AA Change: M1048T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: M1048T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112695
SMART Domains Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Blast:ZnF_C2H2 39 65 2e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112696
AA Change: M1079T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: M1079T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 767 783 N/A INTRINSIC
low complexity region 802 819 N/A INTRINSIC
ZnF_C2H2 959 981 1.07e0 SMART
ZnF_C2H2 1034 1056 1.43e-1 SMART
low complexity region 1230 1243 N/A INTRINSIC
ZnF_C2H2 1257 1283 5.4e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112698
AA Change: M1048T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: M1048T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122980
Predicted Effect probably benign
Transcript: ENSMUST00000124263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125895
Predicted Effect probably benign
Transcript: ENSMUST00000127434
SMART Domains Protein: ENSMUSP00000122421
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135108
Predicted Effect probably benign
Transcript: ENSMUST00000137285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149128
Predicted Effect probably benign
Transcript: ENSMUST00000155495
Meta Mutation Damage Score 0.1066 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dmxl1 T C 18: 49,878,163 I1129T probably benign Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Elp4 T A 2: 105,702,743 H419L probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mapk8ip3 A C 17: 24,904,051 D610E probably benign Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Muc5ac T C 7: 141,796,304 F595L probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Nod1 C T 6: 54,944,440 V298M probably damaging Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Other mutations in Zfp644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Zfp644 APN 5 106638637 critical splice acceptor site probably null
IGL01654:Zfp644 APN 5 106635930 missense probably damaging 1.00
IGL01967:Zfp644 APN 5 106638243 missense probably damaging 1.00
IGL02132:Zfp644 APN 5 106635894 missense probably benign 0.22
IGL02164:Zfp644 APN 5 106638099 missense probably benign 0.01
IGL02303:Zfp644 APN 5 106637314 missense probably damaging 1.00
IGL03091:Zfp644 APN 5 106636858 missense probably damaging 1.00
IGL03102:Zfp644 APN 5 106637268 missense probably damaging 0.99
IGL03298:Zfp644 APN 5 106635101 missense possibly damaging 0.93
PIT4466001:Zfp644 UTSW 5 106636477 missense probably damaging 0.99
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0178:Zfp644 UTSW 5 106636905 missense probably damaging 1.00
R0497:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1302:Zfp644 UTSW 5 106634899 missense probably damaging 1.00
R1337:Zfp644 UTSW 5 106637554 missense probably damaging 0.99
R1400:Zfp644 UTSW 5 106637470 splice site probably null
R1597:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R2021:Zfp644 UTSW 5 106635682 missense possibly damaging 0.84
R2196:Zfp644 UTSW 5 106638603 start codon destroyed probably null 0.02
R2256:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R2311:Zfp644 UTSW 5 106634956 missense probably benign 0.21
R2420:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2421:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2422:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R3752:Zfp644 UTSW 5 106636383 missense probably benign
R4207:Zfp644 UTSW 5 106618276 missense probably damaging 1.00
R4285:Zfp644 UTSW 5 106635118 missense probably damaging 1.00
R4874:Zfp644 UTSW 5 106635413 missense probably damaging 1.00
R4961:Zfp644 UTSW 5 106618215 utr 3 prime probably benign
R4984:Zfp644 UTSW 5 106636917 missense possibly damaging 0.96
R5007:Zfp644 UTSW 5 106636001 missense probably benign
R5358:Zfp644 UTSW 5 106635675 missense probably damaging 1.00
R5382:Zfp644 UTSW 5 106634869 missense possibly damaging 0.88
R5416:Zfp644 UTSW 5 106618428 splice site silent
R5641:Zfp644 UTSW 5 106619595 missense probably damaging 1.00
R5656:Zfp644 UTSW 5 106637982 missense probably benign 0.12
R5732:Zfp644 UTSW 5 106637123 missense probably damaging 1.00
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6306:Zfp644 UTSW 5 106638124 missense probably damaging 0.99
R6317:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R6354:Zfp644 UTSW 5 106636753 missense probably benign 0.23
R6886:Zfp644 UTSW 5 106637911 missense possibly damaging 0.53
R7223:Zfp644 UTSW 5 106637582 nonsense probably null
R7326:Zfp644 UTSW 5 106638277 missense probably benign 0.12
R7450:Zfp644 UTSW 5 106638526 missense probably benign 0.00
R8095:Zfp644 UTSW 5 106618414 missense possibly damaging 0.93
R8710:Zfp644 UTSW 5 106635131 missense probably damaging 0.99
R8822:Zfp644 UTSW 5 106635221 missense possibly damaging 0.93
X0011:Zfp644 UTSW 5 106618427 missense probably damaging 1.00
Z1176:Zfp644 UTSW 5 106635744 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGCAGACACTGAGAGAGCC -3'
(R):5'- TCAGAGGAGGTGAAAACTGTGTTTG -3'

Sequencing Primer
(F):5'- ACACTGAGAGAGCCTCTGTCTTTAG -3'
(R):5'- GTTTGGTCCTTTTTAGAATCACACAG -3'
Posted On2014-06-30