Incidental Mutation 'R1911:Nod1'
ID210258
Institutional Source Beutler Lab
Gene Symbol Nod1
Ensembl Gene ENSMUSG00000038058
Gene Namenucleotide-binding oligomerization domain containing 1
SynonymsCard4, F830007N14Rik, Nlrc1
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location54923949-54972612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54944440 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 298 (V298M)
Ref Sequence ENSEMBL: ENSMUSP00000130487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060655] [ENSMUST00000168172] [ENSMUST00000203076]
Predicted Effect probably damaging
Transcript: ENSMUST00000060655
AA Change: V298M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055747
Gene: ENSMUSG00000038058
AA Change: V298M

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 4.7e-21 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 1.3e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168172
AA Change: V298M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130487
Gene: ENSMUSG00000038058
AA Change: V298M

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 7.6e-20 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 6.2e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203076
SMART Domains Protein: ENSMUSP00000145123
Gene: ENSMUSG00000038058

DomainStartEndE-ValueType
low complexity region 82 91 N/A INTRINSIC
LRR 101 128 5.3e-3 SMART
LRR 157 184 4.8e-4 SMART
LRR 185 212 1.7e-6 SMART
LRR 213 240 6.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205242
Meta Mutation Damage Score 0.2707 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOD (nucleotide-binding oligomerization domain) family. This member is a cytosolic protein. It contains an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. This protein is an intracellular pattern-recognition receptor (PRR) that initiates inflammation in response to a subset of bacteria through the detection of bacterial diaminopimelic acid. Multiple alternatively spliced transcript variants differring in the 5' UTR have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice were viable, fertile, and appeared normal in a specific-pathogen free environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dmxl1 T C 18: 49,878,163 I1129T probably benign Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Elp4 T A 2: 105,702,743 H419L probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mapk8ip3 A C 17: 24,904,051 D610E probably benign Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Muc5ac T C 7: 141,796,304 F595L probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Zfp644 A G 5: 106,635,271 M1079T possibly damaging Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Other mutations in Nod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Nod1 APN 6 54944946 missense probably damaging 1.00
IGL00937:Nod1 APN 6 54937364 missense probably benign 0.08
IGL00945:Nod1 APN 6 54944586 splice site probably null
IGL01410:Nod1 APN 6 54944356 missense probably damaging 1.00
IGL02094:Nod1 APN 6 54939390 splice site probably null
IGL02217:Nod1 APN 6 54943419 missense possibly damaging 0.63
IGL02573:Nod1 APN 6 54943945 missense probably benign 0.02
IGL02944:Nod1 APN 6 54924947 missense possibly damaging 0.68
R0092:Nod1 UTSW 6 54944541 missense probably damaging 1.00
R0108:Nod1 UTSW 6 54943749 missense probably benign 0.27
R0148:Nod1 UTSW 6 54938217 missense probably damaging 1.00
R0771:Nod1 UTSW 6 54944269 missense probably damaging 0.96
R1493:Nod1 UTSW 6 54944056 missense probably damaging 1.00
R1540:Nod1 UTSW 6 54943975 missense probably benign 0.09
R1660:Nod1 UTSW 6 54944233 splice site probably null
R1710:Nod1 UTSW 6 54944059 missense probably damaging 0.98
R2008:Nod1 UTSW 6 54939325 missense probably damaging 1.00
R3409:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3410:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3927:Nod1 UTSW 6 54944917 missense probably benign 0.01
R4499:Nod1 UTSW 6 54943996 missense probably damaging 1.00
R4608:Nod1 UTSW 6 54943756 missense probably damaging 1.00
R5552:Nod1 UTSW 6 54944631 missense probably damaging 1.00
R5667:Nod1 UTSW 6 54933576 missense probably benign 0.06
R5859:Nod1 UTSW 6 54930177 missense probably benign 0.08
R5868:Nod1 UTSW 6 54939327 missense probably damaging 1.00
R5995:Nod1 UTSW 6 54944554 missense probably damaging 0.99
R6329:Nod1 UTSW 6 54944704 missense probably benign 0.00
R6331:Nod1 UTSW 6 54924983 missense probably damaging 1.00
R6642:Nod1 UTSW 6 54948029 missense probably damaging 1.00
R6798:Nod1 UTSW 6 54944611 missense probably damaging 0.97
R6889:Nod1 UTSW 6 54944109 missense probably benign 0.27
R7582:Nod1 UTSW 6 54944307 missense probably damaging 1.00
R8123:Nod1 UTSW 6 54937406 missense probably damaging 1.00
R8317:Nod1 UTSW 6 54943440 missense probably damaging 1.00
R8338:Nod1 UTSW 6 54943971 missense probably damaging 0.97
R8524:Nod1 UTSW 6 54948075 missense probably damaging 1.00
R8896:Nod1 UTSW 6 54944292 missense probably benign 0.03
R8961:Nod1 UTSW 6 54949476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCCAACAGAAGAGCGGC -3'
(R):5'- CTGCTTCAAGGAGAGCGACATG -3'

Sequencing Primer
(F):5'- TTGGCATCCAGCTGCTG -3'
(R):5'- ACATGCTGAGTCTGCAGGAC -3'
Posted On2014-06-30