Mutagenetix > Incidental Mutations

Incidental Mutation 'R0121:Adgra3'

21026

Institutional Source

Beutler Lab

Gene Symbol

Adgra3

Ensembl Gene

ENSMUSG00000029090

Gene Name

adhesion G protein-coupled receptor A3

Synonyms

Gpr125, Tem5-like, 3830613O22Rik

MMRRC Submission

038406-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0121 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49959956-50059006 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 50025786 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030971]

Predicted Effect

probably benign
Transcript: ENSMUST00000030971

SMART Domains

Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	36	48	N/A	INTRINSIC
LRR	68	92	1.71e1	SMART
LRR_TYP	93	116	2.27e-4	SMART
LRR_TYP	117	140	4.11e-2	SMART
LRR_TYP	141	164	3.89e-3	SMART
LRRCT	176	225	5.24e-5	SMART
IG	238	331	8.26e-5	SMART
GPS	686	738	4.81e-3	SMART
Pfam:7tm_2	746	1031	1.6e-16	PFAM
low complexity region	1251	1262	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 89.8%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,259,786		probably null	Het
Anxa7	A	T	14: 20,460,159	L386M	probably damaging	Het
Ap2b1	A	G	11: 83,321,967	M58V	possibly damaging	Het
Arfip2	A	G	7: 105,636,371	L224P	probably damaging	Het
Arhgap20	A	G	9: 51,838,951	N373S	possibly damaging	Het
Asph	T	C	4: 9,635,918	D73G	probably damaging	Het
Atp1a2	T	A	1: 172,289,342	E236V	probably damaging	Het
Atp2a1	A	G	7: 126,457,944	S170P	probably damaging	Het
Atp4a	C	G	7: 30,720,101	R659G	probably benign	Het
B4galnt3	C	T	6: 120,215,038	R578H	probably benign	Het
Ccdc178	C	A	18: 21,845,024		probably null	Het
Ccnh	T	A	13: 85,206,193	M252K	probably damaging	Het
Clec4b2	A	G	6: 123,204,172	D172G	probably benign	Het
Col1a1	A	G	11: 94,938,069	E79G	unknown	Het
Csf3r	A	G	4: 126,029,849	N51D	probably benign	Het
Cul7	C	T	17: 46,663,373	L1489F	probably damaging	Het
Cyp2b13	G	A	7: 26,086,585	C309Y	probably benign	Het
Dync2h1	A	T	9: 7,001,327		probably benign	Het
Edn1	A	G	13: 42,305,265	T135A	probably benign	Het
Ephb2	A	G	4: 136,771,057	I237T	probably damaging	Het
Fam111a	T	A	19: 12,584,080	F12L	probably benign	Het
Foxi2	C	A	7: 135,411,911	A290E	probably benign	Het
Gabra6	A	G	11: 42,314,971	S353P	probably benign	Het
Gm4847	T	C	1: 166,642,288	D72G	probably damaging	Het
Grhl3	A	G	4: 135,552,549	I398T	probably damaging	Het
Gtdc1	T	C	2: 44,565,538		probably benign	Het
Kel	A	C	6: 41,702,064		probably benign	Het
L3mbtl3	C	T	10: 26,313,870	D499N	unknown	Het
Lama1	T	A	17: 67,798,513		probably benign	Het
Mamdc2	T	A	19: 23,310,859	E605V	probably benign	Het
Nolc1	G	A	19: 46,081,378		probably benign	Het
Nudt12	A	T	17: 59,007,639	S317T	possibly damaging	Het
Olfr1085	A	G	2: 86,657,819	V213A	probably benign	Het
Olfr1153	A	G	2: 87,897,090	K297R	possibly damaging	Het
Olfr1277	A	T	2: 111,270,314	C18S	probably benign	Het
Olfr937	T	A	9: 39,059,760	K302M	probably damaging	Het
Optn	C	T	2: 5,024,115	G526R	probably damaging	Het
Pbld1	C	T	10: 63,071,503		probably benign	Het
Prl8a9	T	G	13: 27,560,606	N84T	probably benign	Het
Psph	T	A	5: 129,791,570		probably benign	Het
Sbf2	A	G	7: 110,489,219		probably null	Het
Senp6	A	G	9: 80,116,670	D405G	probably benign	Het
Serpinb1a	T	A	13: 32,848,771		probably benign	Het
Slc2a9	T	C	5: 38,398,743	I287V	probably benign	Het
Sptbn2	T	C	19: 4,745,293	F1593S	probably damaging	Het
Tcf21	T	C	10: 22,819,807	T33A	probably benign	Het
Tdrd3	A	T	14: 87,539,479	Q727L	probably damaging	Het
Tecpr1	C	T	5: 144,210,199	E450K	probably benign	Het
Tenm3	G	A	8: 48,342,659	T532I	probably damaging	Het
Tg	A	T	15: 66,740,781	Q396L	probably benign	Het
Tmtc3	A	G	10: 100,458,908		probably benign	Het
Twnk	T	C	19: 45,009,265		probably benign	Het
Ubac1	A	G	2: 26,008,859		probably null	Het
Ubn2	T	C	6: 38,452,858		probably benign	Het
Zfp944	T	A	17: 22,339,268	T333S	possibly damaging	Het

Other mutations in Adgra3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Adgra3	APN	5	50025758	missense	probably damaging	1.00
IGL00848:Adgra3	APN	5	50001949	missense	probably damaging	1.00
IGL01455:Adgra3	APN	5	49987557	nonsense	probably null
IGL01665:Adgra3	APN	5	50006930	missense	possibly damaging	0.64
IGL02151:Adgra3	APN	5	49979142	missense	probably benign
IGL02239:Adgra3	APN	5	49960712	missense	probably damaging	1.00
IGL02351:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02358:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02938:Adgra3	APN	5	49961317	missense	probably benign	0.01
IGL03028:Adgra3	APN	5	50016852	missense	probably benign	0.30
aperture	UTSW	5	49999145	nonsense	probably null
saltatory	UTSW	5	49960559	missense	probably benign	0.09
ANU74:Adgra3	UTSW	5	49961038	missense	probably benign	0.16
R0041:Adgra3	UTSW	5	49960559	missense	probably benign	0.09
R0125:Adgra3	UTSW	5	50001852	splice site	probably benign
R0137:Adgra3	UTSW	5	49963840	splice site	probably benign
R0415:Adgra3	UTSW	5	49961757	splice site	probably benign
R0479:Adgra3	UTSW	5	49990265	missense	probably benign	0.00
R0505:Adgra3	UTSW	5	50009334	critical splice donor site	probably null
R0831:Adgra3	UTSW	5	49970802	missense	probably damaging	1.00
R0883:Adgra3	UTSW	5	49960723	missense	probably damaging	1.00
R0920:Adgra3	UTSW	5	49961161	missense	probably benign	0.19
R1139:Adgra3	UTSW	5	49961755	splice site	probably null
R1211:Adgra3	UTSW	5	50006876	missense	possibly damaging	0.88
R1370:Adgra3	UTSW	5	49960787	missense	possibly damaging	0.56
R1530:Adgra3	UTSW	5	49961137	missense	probably benign	0.00
R1703:Adgra3	UTSW	5	50006775	missense	probably benign	0.00
R1782:Adgra3	UTSW	5	49972062	missense	probably benign	0.02
R1843:Adgra3	UTSW	5	49961492	missense	probably damaging	1.00
R2157:Adgra3	UTSW	5	50001941	missense	possibly damaging	0.87
R2281:Adgra3	UTSW	5	50001880	missense	probably benign	0.04
R2385:Adgra3	UTSW	5	49979566	missense	possibly damaging	0.95
R2426:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R3084:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3086:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3409:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3410:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3411:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R4301:Adgra3	UTSW	5	49961078	missense	possibly damaging	0.94
R4360:Adgra3	UTSW	5	49990210	missense	possibly damaging	0.92
R4475:Adgra3	UTSW	5	50001898	missense	probably damaging	1.00
R4569:Adgra3	UTSW	5	49960563	missense	probably damaging	1.00
R4607:Adgra3	UTSW	5	49970739	missense	probably damaging	0.98
R4667:Adgra3	UTSW	5	49978956	missense	possibly damaging	0.94
R4671:Adgra3	UTSW	5	49979368	missense	probably damaging	1.00
R4886:Adgra3	UTSW	5	49999195	missense	probably benign	0.07
R5197:Adgra3	UTSW	5	49960754	missense	probably benign	0.01
R5208:Adgra3	UTSW	5	50011515	missense	probably damaging	0.99
R5313:Adgra3	UTSW	5	49961309	missense	probably benign	0.24
R5435:Adgra3	UTSW	5	49990126	missense	probably damaging	0.99
R5663:Adgra3	UTSW	5	49999285	missense	probably benign	0.14
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6064:Adgra3	UTSW	5	49960325	missense	probably damaging	0.97
R6259:Adgra3	UTSW	5	49999141	missense	possibly damaging	0.63
R6272:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R6293:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6296:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6297:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6352:Adgra3	UTSW	5	49979136	missense	probably benign
R6352:Adgra3	UTSW	5	49990250	missense	probably benign	0.01
R6989:Adgra3	UTSW	5	50006884	missense	probably damaging	1.00
R7026:Adgra3	UTSW	5	49960741	missense	probably benign
R7147:Adgra3	UTSW	5	49961245	missense	probably damaging	1.00
R7206:Adgra3	UTSW	5	50006896	missense	probably damaging	1.00
R7381:Adgra3	UTSW	5	50058774	start codon destroyed	probably null
R7508:Adgra3	UTSW	5	50016867	missense	probably benign	0.10
R7538:Adgra3	UTSW	5	49961450	missense	probably benign	0.01
R7579:Adgra3	UTSW	5	49987635	missense	probably benign
R7951:Adgra3	UTSW	5	49963784	missense	probably damaging	1.00
R8269:Adgra3	UTSW	5	49963737	missense	probably damaging	0.98
R8458:Adgra3	UTSW	5	49987671	missense	probably damaging	0.99
R8486:Adgra3	UTSW	5	49990279	missense	probably damaging	0.98
RF005:Adgra3	UTSW	5	50013387	splice site	probably null
RF024:Adgra3	UTSW	5	50013387	splice site	probably null
RF036:Adgra3	UTSW	5	50058641	small deletion	probably benign
X0065:Adgra3	UTSW	5	49971962	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCTCATTACTGCCGGAATCACTTG -3'
(R):5'- TCCGTGGTGACCAGCTTTACCTTG -3'

Sequencing Primer
(F):5'- TTGATCACTTCACGGCAGAG -3'
(R):5'- GTGACCAGCTTTACCTTGTATTGAAC -3'

Posted On

2013-04-11