Incidental Mutation 'R1911:Muc5ac'
ID210274
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Namemucin 5, subtypes A and C, tracheobronchial/gastric
SynonymsMGM, 2210005L13Rik
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141788972-141819231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141796304 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 595 (F595L)
Ref Sequence ENSEMBL: ENSMUSP00000131681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
Predicted Effect probably benign
Transcript: ENSMUST00000041924
AA Change: F595L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: F595L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155534
AA Change: F596L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: F596L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
AA Change: F595L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: F595L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dmxl1 T C 18: 49,878,163 I1129T probably benign Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Elp4 T A 2: 105,702,743 H419L probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mapk8ip3 A C 17: 24,904,051 D610E probably benign Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Nod1 C T 6: 54,944,440 V298M probably damaging Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Zfp644 A G 5: 106,635,271 M1079T possibly damaging Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141812703 missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141807473 missense probably benign 0.12
IGL01155:Muc5ac APN 7 141806943 splice site probably benign
IGL01452:Muc5ac APN 7 141817555 missense probably benign 0.00
IGL01590:Muc5ac APN 7 141798893 missense probably benign 0.02
IGL02104:Muc5ac APN 7 141811078 missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141800177 missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141818800 nonsense probably null
IGL02178:Muc5ac APN 7 141805447 splice site probably benign
IGL02403:Muc5ac APN 7 141803450 missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141817044 missense probably benign 0.01
IGL02665:Muc5ac APN 7 141791086 missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141795263 missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141805775 missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141813781 missense probably benign 0.34
IGL03384:Muc5ac APN 7 141812403 missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141795213 missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141807416 missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141818630 missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141795275 missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141811039 missense probably benign 0.08
R0363:Muc5ac UTSW 7 141800960 missense probably benign 0.01
R0384:Muc5ac UTSW 7 141812251 missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141792034 nonsense probably null
R0583:Muc5ac UTSW 7 141807608 missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141796244 missense probably benign 0.02
R0682:Muc5ac UTSW 7 141805669 missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141807709 missense probably benign 0.03
R0883:Muc5ac UTSW 7 141796265 missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141807515 missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141816929 missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141807323 missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141807377 missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141813892 splice site probably null
R1599:Muc5ac UTSW 7 141798903 missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141801531 missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141807086 missense probably benign 0.00
R1922:Muc5ac UTSW 7 141793689 missense probably benign 0.03
R1966:Muc5ac UTSW 7 141803376 missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141813152 missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141792035 missense probably benign 0.01
R2126:Muc5ac UTSW 7 141810742 missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141812347 missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2259:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2293:Muc5ac UTSW 7 141807199 missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141818104 missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141791140 missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141807641 missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141792736 splice site probably null
R3762:Muc5ac UTSW 7 141807475 missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141798501 missense probably benign 0.32
R3806:Muc5ac UTSW 7 141813734 missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141814723 missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141791224 missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141802892 missense probably benign
R3981:Muc5ac UTSW 7 141813775 missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141799844 critical splice donor site probably null
R4043:Muc5ac UTSW 7 141807478 missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141811130 missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141802835 missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141817110 missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141791103 missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141789763 missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141817601 missense probably benign 0.00
R4789:Muc5ac UTSW 7 141798882 missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141817902 nonsense probably null
R4971:Muc5ac UTSW 7 141816278 missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141809456 intron probably benign
R5088:Muc5ac UTSW 7 141796319 missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141814742 missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141793971 missense probably benign 0.32
R5366:Muc5ac UTSW 7 141807550 missense probably benign 0.01
R5497:Muc5ac UTSW 7 141807643 missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141807832 missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141793715 critical splice donor site probably null
R5811:Muc5ac UTSW 7 141798984 missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141817907 missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141790669 nonsense probably null
R5977:Muc5ac UTSW 7 141796367 missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141811857 missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141801232 missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141815586 missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141789795 missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141816864 nonsense probably null
R6341:Muc5ac UTSW 7 141801492 missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141812679 missense probably benign 0.05
R6481:Muc5ac UTSW 7 141809071 intron probably benign
R6483:Muc5ac UTSW 7 141802854 missense probably benign 0.18
R6627:Muc5ac UTSW 7 141808690 intron probably benign
R6636:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141803328 missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141798992 missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141809552 intron probably benign
R6844:Muc5ac UTSW 7 141809744 intron probably benign
R6847:Muc5ac UTSW 7 141809744 intron probably benign
R6852:Muc5ac UTSW 7 141816907 missense probably benign 0.03
R6862:Muc5ac UTSW 7 141809744 intron probably benign
R6863:Muc5ac UTSW 7 141809744 intron probably benign
R6864:Muc5ac UTSW 7 141809744 intron probably benign
R6865:Muc5ac UTSW 7 141809744 intron probably benign
R6874:Muc5ac UTSW 7 141809744 intron probably benign
R6875:Muc5ac UTSW 7 141809744 intron probably benign
R6876:Muc5ac UTSW 7 141809744 intron probably benign
R6877:Muc5ac UTSW 7 141809744 intron probably benign
R6889:Muc5ac UTSW 7 141809744 intron probably benign
R6920:Muc5ac UTSW 7 141793298 missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141818714 missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141809687 intron probably benign
R7091:Muc5ac UTSW 7 141809687 intron probably benign
R7092:Muc5ac UTSW 7 141809648 intron probably benign
R7092:Muc5ac UTSW 7 141809687 intron probably benign
R7110:Muc5ac UTSW 7 141799822 missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141813822 nonsense probably null
R7238:Muc5ac UTSW 7 141809517 missense unknown
R7238:Muc5ac UTSW 7 141809687 intron probably benign
R7396:Muc5ac UTSW 7 141808415 missense unknown
R7456:Muc5ac UTSW 7 141793167 missense probably benign 0.32
R7477:Muc5ac UTSW 7 141816282 missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141813799 missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141808668 missense unknown
R7604:Muc5ac UTSW 7 141809709 missense unknown
R7635:Muc5ac UTSW 7 141805676 missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141805753 missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141809422 missense unknown
R7651:Muc5ac UTSW 7 141796254 missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141809383 missense unknown
R7720:Muc5ac UTSW 7 141809303 missense unknown
R7749:Muc5ac UTSW 7 141809303 missense unknown
R7750:Muc5ac UTSW 7 141809303 missense unknown
R7751:Muc5ac UTSW 7 141809303 missense unknown
R7754:Muc5ac UTSW 7 141809303 missense unknown
R7798:Muc5ac UTSW 7 141794041 critical splice donor site probably null
R7835:Muc5ac UTSW 7 141809303 missense unknown
R7837:Muc5ac UTSW 7 141815963 missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141803429 missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141795852 missense probably benign 0.00
R7874:Muc5ac UTSW 7 141809303 missense unknown
R7876:Muc5ac UTSW 7 141809303 missense unknown
R7877:Muc5ac UTSW 7 141809303 missense unknown
R7881:Muc5ac UTSW 7 141809303 missense unknown
R7884:Muc5ac UTSW 7 141809303 missense unknown
R7921:Muc5ac UTSW 7 141809687 intron probably benign
R7976:Muc5ac UTSW 7 141809791 missense unknown
R8104:Muc5ac UTSW 7 141804783 missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141807331 missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141802948 missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141809263 missense unknown
R8386:Muc5ac UTSW 7 141807634 missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141810476 missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141807155 missense probably damaging 1.00
X0060:Muc5ac UTSW 7 141803333 missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141809744 intron probably benign
Z1088:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
Z1177:Muc5ac UTSW 7 141809224 missense unknown
Z1177:Muc5ac UTSW 7 141818040 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGCTAACCTGTGGTAAGAAGC -3'
(R):5'- GTAGATAGCTGGACACCAAGCC -3'

Sequencing Primer
(F):5'- TAAGAAGCACTGACTCTGGGTCTG -3'
(R):5'- CACCAAGCCAGGTCAGAGTTTG -3'
Posted On2014-06-30