Incidental Mutation 'R1911:Muc5ac'
ID 210274
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
MMRRC Submission 039929-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1911 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141342709-141372968 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141350041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 595 (F595L)
Ref Sequence ENSEMBL: ENSMUSP00000131681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041924
AA Change: F595L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: F595L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155534
AA Change: F596L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: F596L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
AA Change: F595L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: F595L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,927,050 (GRCm39) probably benign Het
Abca7 T C 10: 79,842,468 (GRCm39) V1134A probably benign Het
Acaa2 A G 18: 74,925,483 (GRCm39) E82G probably benign Het
Acap1 T C 11: 69,772,548 (GRCm39) D521G probably damaging Het
Adam19 T C 11: 46,012,281 (GRCm39) V259A probably damaging Het
Adss1 T C 12: 112,599,443 (GRCm39) V140A probably benign Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Aldh3b1 T G 19: 3,971,187 (GRCm39) D159A probably damaging Het
Ank1 T C 8: 23,589,666 (GRCm39) V589A probably damaging Het
Ano2 G A 6: 125,990,654 (GRCm39) D803N probably benign Het
Arid1b A G 17: 5,393,241 (GRCm39) E2257G probably damaging Het
Asb17 T C 3: 153,550,138 (GRCm39) Y57H probably benign Het
Asph T C 4: 9,453,335 (GRCm39) E646G probably damaging Het
Aspm T A 1: 139,405,832 (GRCm39) I1573K probably benign Het
Bcas1 C A 2: 170,229,863 (GRCm39) D236Y probably damaging Het
Bcas2 G T 3: 103,079,113 (GRCm39) G9* probably null Het
Btaf1 A G 19: 36,964,030 (GRCm39) Q867R probably benign Het
Calhm3 C T 19: 47,143,908 (GRCm39) V132I possibly damaging Het
Ccer1 A T 10: 97,530,539 (GRCm39) I401F possibly damaging Het
Cdcp3 T C 7: 130,839,818 (GRCm39) V580A probably damaging Het
Cecr2 T A 6: 120,739,526 (GRCm39) probably benign Het
Cep104 G A 4: 154,091,255 (GRCm39) R925Q possibly damaging Het
Cep164 T A 9: 45,682,104 (GRCm39) M1900L probably benign Het
Crybg1 A G 10: 43,873,673 (GRCm39) V1145A possibly damaging Het
Cyp2a4 T A 7: 26,008,399 (GRCm39) N180K possibly damaging Het
Dennd4a T C 9: 64,796,368 (GRCm39) L798P probably damaging Het
Dmxl1 T C 18: 50,011,230 (GRCm39) I1129T probably benign Het
Dnah2 T C 11: 69,406,578 (GRCm39) N555D possibly damaging Het
Dock1 T A 7: 134,601,029 (GRCm39) M988K probably damaging Het
Elp4 T A 2: 105,533,088 (GRCm39) H419L probably damaging Het
Endov T C 11: 119,393,177 (GRCm39) V109A possibly damaging Het
Epha8 T C 4: 136,663,625 (GRCm39) Y477C probably damaging Het
Erlin1 A G 19: 44,037,561 (GRCm39) M188T probably damaging Het
Fhip1a T A 3: 85,568,525 (GRCm39) D998V probably benign Het
Fhod3 A T 18: 25,245,643 (GRCm39) D1231V possibly damaging Het
Gimap3 T A 6: 48,742,646 (GRCm39) I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Grk1 C A 8: 13,457,923 (GRCm39) D274E probably damaging Het
Gsdmc2 G A 15: 63,699,621 (GRCm39) A269V probably benign Het
Krt33a T A 11: 99,903,175 (GRCm39) Q289L probably benign Het
Krt76 T A 15: 101,796,600 (GRCm39) K403* probably null Het
Lcn4 T C 2: 26,560,607 (GRCm39) probably benign Het
Mab21l1 T C 3: 55,691,048 (GRCm39) S212P possibly damaging Het
Mapk8ip3 A C 17: 25,123,025 (GRCm39) D610E probably benign Het
Mastl G T 2: 23,022,692 (GRCm39) S677* probably null Het
Mfap3 T C 11: 57,420,562 (GRCm39) F181S probably damaging Het
Mlkl T C 8: 112,038,732 (GRCm39) probably benign Het
Mov10 G A 3: 104,708,876 (GRCm39) probably benign Het
Nbas T A 12: 13,616,145 (GRCm39) C2228S probably benign Het
Nit2 G A 16: 56,982,046 (GRCm39) probably benign Het
Nod1 C T 6: 54,921,425 (GRCm39) V298M probably damaging Het
Or3a4 C A 11: 73,945,210 (GRCm39) R125L probably damaging Het
Or4c111 A G 2: 88,843,565 (GRCm39) L281P probably damaging Het
Or52b1 T A 7: 104,978,590 (GRCm39) I270F probably benign Het
Or6c210 A T 10: 129,495,981 (GRCm39) D102V probably benign Het
Or7g12 T C 9: 18,900,196 (GRCm39) L304P probably damaging Het
Osbpl5 C A 7: 143,243,662 (GRCm39) R864L probably benign Het
Pcnt G A 10: 76,204,650 (GRCm39) T2585M possibly damaging Het
Pepd C T 7: 34,634,174 (GRCm39) probably benign Het
Pou6f2 T C 13: 18,326,548 (GRCm39) I341V probably damaging Het
Pramel32 T C 4: 88,548,309 (GRCm39) Q32R possibly damaging Het
Prune2 T A 19: 17,091,038 (GRCm39) F281I probably benign Het
Psg19 T G 7: 18,528,193 (GRCm39) Q183H probably damaging Het
Psme4 T G 11: 30,765,658 (GRCm39) S587A probably benign Het
Ptpro T C 6: 137,377,617 (GRCm39) probably benign Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rasgrp4 T C 7: 28,838,302 (GRCm39) V92A probably damaging Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Rexo5 C T 7: 119,398,867 (GRCm39) A68V probably damaging Het
Robo2 A T 16: 73,755,213 (GRCm39) N769K probably damaging Het
Sfrp5 C T 19: 42,187,237 (GRCm39) V278I probably benign Het
Sidt1 A G 16: 44,102,234 (GRCm39) S309P possibly damaging Het
Slc22a6 A C 19: 8,599,246 (GRCm39) Q292H probably benign Het
Slc4a3 G A 1: 75,530,367 (GRCm39) R690H probably damaging Het
Snx7 A T 3: 117,623,317 (GRCm39) probably null Het
Spag6 T A 2: 18,720,616 (GRCm39) Y129* probably null Het
Srcap T C 7: 127,133,994 (GRCm39) I905T probably damaging Het
St6gal1 T G 16: 23,140,383 (GRCm39) S185A probably damaging Het
Sult6b1 G A 17: 79,196,393 (GRCm39) H250Y possibly damaging Het
Tdrd6 T G 17: 43,937,979 (GRCm39) N1023T probably benign Het
Tecta C T 9: 42,249,232 (GRCm39) E1877K probably damaging Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tex14 T A 11: 87,385,861 (GRCm39) D240E probably damaging Het
Tex47 T C 5: 7,355,022 (GRCm39) Y68H probably damaging Het
Thbs2 A G 17: 14,910,104 (GRCm39) V165A probably benign Het
Tmem126b T A 7: 90,118,367 (GRCm39) Y171F possibly damaging Het
Tpsg1 G T 17: 25,592,374 (GRCm39) M46I probably benign Het
Trmt2a A G 16: 18,069,070 (GRCm39) K304R probably benign Het
Ttc28 G T 5: 111,428,616 (GRCm39) R1845L possibly damaging Het
Umodl1 A T 17: 31,211,128 (GRCm39) T884S possibly damaging Het
Vmn2r77 A G 7: 86,461,001 (GRCm39) K776E probably damaging Het
Vmn2r88 T C 14: 51,655,671 (GRCm39) S627P probably damaging Het
Vrk1 T C 12: 106,024,236 (GRCm39) probably null Het
Zfp644 A G 5: 106,783,137 (GRCm39) M1079T possibly damaging Het
Znrf1 T C 8: 112,348,233 (GRCm39) *41Q probably null Het
Znrf1 T C 8: 112,348,244 (GRCm39) F183L possibly damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141,366,440 (GRCm39) missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141,361,210 (GRCm39) missense probably benign 0.12
IGL01155:Muc5ac APN 7 141,360,680 (GRCm39) splice site probably benign
IGL01452:Muc5ac APN 7 141,371,292 (GRCm39) missense probably benign 0.00
IGL01590:Muc5ac APN 7 141,352,630 (GRCm39) missense probably benign 0.02
IGL02104:Muc5ac APN 7 141,364,815 (GRCm39) missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141,353,914 (GRCm39) missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141,372,537 (GRCm39) nonsense probably null
IGL02178:Muc5ac APN 7 141,359,184 (GRCm39) splice site probably benign
IGL02403:Muc5ac APN 7 141,357,187 (GRCm39) missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141,370,781 (GRCm39) missense probably benign 0.01
IGL02665:Muc5ac APN 7 141,344,823 (GRCm39) missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141,349,000 (GRCm39) missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141,359,512 (GRCm39) missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141,367,518 (GRCm39) missense probably benign 0.34
IGL03384:Muc5ac APN 7 141,366,140 (GRCm39) missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141,348,950 (GRCm39) missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141,361,153 (GRCm39) missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141,372,367 (GRCm39) missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141,349,012 (GRCm39) missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141,364,776 (GRCm39) missense probably benign 0.08
R0363:Muc5ac UTSW 7 141,354,697 (GRCm39) missense probably benign 0.01
R0384:Muc5ac UTSW 7 141,365,988 (GRCm39) missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141,345,771 (GRCm39) nonsense probably null
R0583:Muc5ac UTSW 7 141,361,345 (GRCm39) missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141,349,981 (GRCm39) missense probably benign 0.02
R0682:Muc5ac UTSW 7 141,359,406 (GRCm39) missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141,361,446 (GRCm39) missense probably benign 0.03
R0883:Muc5ac UTSW 7 141,350,002 (GRCm39) missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141,361,252 (GRCm39) missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141,370,666 (GRCm39) missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141,361,060 (GRCm39) missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141,361,114 (GRCm39) missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141,367,629 (GRCm39) splice site probably null
R1599:Muc5ac UTSW 7 141,352,640 (GRCm39) missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141,355,268 (GRCm39) missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141,360,823 (GRCm39) missense probably benign 0.00
R1922:Muc5ac UTSW 7 141,347,426 (GRCm39) missense probably benign 0.03
R1966:Muc5ac UTSW 7 141,357,113 (GRCm39) missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141,366,889 (GRCm39) missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141,345,772 (GRCm39) missense probably benign 0.01
R2126:Muc5ac UTSW 7 141,364,479 (GRCm39) missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141,366,084 (GRCm39) missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2259:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2293:Muc5ac UTSW 7 141,360,936 (GRCm39) missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141,371,841 (GRCm39) missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141,344,877 (GRCm39) missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141,361,378 (GRCm39) missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141,346,473 (GRCm39) splice site probably null
R3762:Muc5ac UTSW 7 141,361,212 (GRCm39) missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141,352,238 (GRCm39) missense probably benign 0.32
R3806:Muc5ac UTSW 7 141,367,471 (GRCm39) missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141,368,460 (GRCm39) missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141,344,961 (GRCm39) missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141,356,629 (GRCm39) missense probably benign
R3981:Muc5ac UTSW 7 141,367,512 (GRCm39) missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141,353,581 (GRCm39) critical splice donor site probably null
R4043:Muc5ac UTSW 7 141,361,215 (GRCm39) missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141,364,867 (GRCm39) missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141,356,572 (GRCm39) missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141,370,847 (GRCm39) missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141,344,840 (GRCm39) missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141,343,500 (GRCm39) missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141,371,338 (GRCm39) missense probably benign 0.00
R4789:Muc5ac UTSW 7 141,352,619 (GRCm39) missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141,371,639 (GRCm39) nonsense probably null
R4971:Muc5ac UTSW 7 141,370,015 (GRCm39) missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141,363,193 (GRCm39) intron probably benign
R5088:Muc5ac UTSW 7 141,350,056 (GRCm39) missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141,368,479 (GRCm39) missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141,347,708 (GRCm39) missense probably benign 0.32
R5366:Muc5ac UTSW 7 141,361,287 (GRCm39) missense probably benign 0.01
R5497:Muc5ac UTSW 7 141,361,380 (GRCm39) missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141,361,569 (GRCm39) missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141,347,452 (GRCm39) critical splice donor site probably null
R5811:Muc5ac UTSW 7 141,352,721 (GRCm39) missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141,371,644 (GRCm39) missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141,344,406 (GRCm39) nonsense probably null
R5977:Muc5ac UTSW 7 141,350,104 (GRCm39) missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141,365,594 (GRCm39) missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141,354,969 (GRCm39) missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141,369,323 (GRCm39) missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141,343,532 (GRCm39) missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141,370,601 (GRCm39) nonsense probably null
R6341:Muc5ac UTSW 7 141,355,229 (GRCm39) missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141,366,416 (GRCm39) missense probably benign 0.05
R6481:Muc5ac UTSW 7 141,362,808 (GRCm39) intron probably benign
R6483:Muc5ac UTSW 7 141,356,591 (GRCm39) missense probably benign 0.18
R6627:Muc5ac UTSW 7 141,362,427 (GRCm39) intron probably benign
R6636:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141,357,065 (GRCm39) missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141,352,729 (GRCm39) missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141,363,289 (GRCm39) intron probably benign
R6844:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6847:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6852:Muc5ac UTSW 7 141,370,644 (GRCm39) missense probably benign 0.03
R6862:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6863:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6864:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6865:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6874:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6875:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6876:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6877:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6889:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6920:Muc5ac UTSW 7 141,347,035 (GRCm39) missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141,372,451 (GRCm39) missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7091:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,385 (GRCm39) intron probably benign
R7110:Muc5ac UTSW 7 141,353,559 (GRCm39) missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141,367,559 (GRCm39) nonsense probably null
R7238:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7238:Muc5ac UTSW 7 141,363,254 (GRCm39) missense unknown
R7396:Muc5ac UTSW 7 141,362,152 (GRCm39) missense unknown
R7456:Muc5ac UTSW 7 141,346,904 (GRCm39) missense probably benign 0.32
R7477:Muc5ac UTSW 7 141,370,019 (GRCm39) missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141,367,536 (GRCm39) missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141,362,405 (GRCm39) missense unknown
R7604:Muc5ac UTSW 7 141,363,446 (GRCm39) missense unknown
R7635:Muc5ac UTSW 7 141,359,413 (GRCm39) missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141,359,490 (GRCm39) missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141,363,159 (GRCm39) missense unknown
R7651:Muc5ac UTSW 7 141,349,991 (GRCm39) missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141,363,120 (GRCm39) missense unknown
R7720:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7749:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7750:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7751:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7754:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7798:Muc5ac UTSW 7 141,347,778 (GRCm39) critical splice donor site probably null
R7835:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7837:Muc5ac UTSW 7 141,369,700 (GRCm39) missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141,357,166 (GRCm39) missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141,349,589 (GRCm39) missense probably benign 0.00
R7874:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7876:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7877:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7881:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7884:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7921:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7976:Muc5ac UTSW 7 141,363,528 (GRCm39) missense unknown
R8104:Muc5ac UTSW 7 141,358,520 (GRCm39) missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141,361,068 (GRCm39) missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141,356,685 (GRCm39) missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141,363,000 (GRCm39) missense unknown
R8386:Muc5ac UTSW 7 141,361,371 (GRCm39) missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141,364,213 (GRCm39) missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141,360,892 (GRCm39) missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141,370,663 (GRCm39) missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8727:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8754:Muc5ac UTSW 7 141,354,008 (GRCm39) missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141,372,609 (GRCm39) missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141,343,493 (GRCm39) missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141,347,091 (GRCm39) missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141,362,712 (GRCm39) missense unknown
R9124:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9131:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9132:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9135:Muc5ac UTSW 7 141,352,218 (GRCm39) missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9157:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9159:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9160:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9161:Muc5ac UTSW 7 141,353,026 (GRCm39) missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141,366,093 (GRCm39) missense possibly damaging 0.92
R9183:Muc5ac UTSW 7 141,352,637 (GRCm39) missense possibly damaging 0.71
R9218:Muc5ac UTSW 7 141,361,098 (GRCm39) missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141,370,800 (GRCm39) nonsense probably null
R9239:Muc5ac UTSW 7 141,353,954 (GRCm39) missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141,364,215 (GRCm39) missense probably benign 0.11
R9287:Muc5ac UTSW 7 141,361,626 (GRCm39) missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141,369,255 (GRCm39) missense probably benign 0.01
R9327:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141,362,559 (GRCm39) missense unknown
R9430:Muc5ac UTSW 7 141,362,569 (GRCm39) missense unknown
R9454:Muc5ac UTSW 7 141,362,431 (GRCm39) missense unknown
R9483:Muc5ac UTSW 7 141,365,465 (GRCm39) nonsense probably null
R9581:Muc5ac UTSW 7 141,363,799 (GRCm39) missense unknown
R9610:Muc5ac UTSW 7 141,350,078 (GRCm39) missense possibly damaging 0.86
R9642:Muc5ac UTSW 7 141,349,601 (GRCm39) missense possibly damaging 0.71
R9684:Muc5ac UTSW 7 141,364,798 (GRCm39) missense probably benign 0.41
R9760:Muc5ac UTSW 7 141,360,985 (GRCm39) missense probably benign 0.05
R9778:Muc5ac UTSW 7 141,349,021 (GRCm39) nonsense probably null
X0060:Muc5ac UTSW 7 141,357,070 (GRCm39) missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
Z1088:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
Z1177:Muc5ac UTSW 7 141,371,777 (GRCm39) missense probably benign 0.33
Z1177:Muc5ac UTSW 7 141,362,961 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGCTAACCTGTGGTAAGAAGC -3'
(R):5'- GTAGATAGCTGGACACCAAGCC -3'

Sequencing Primer
(F):5'- TAAGAAGCACTGACTCTGGGTCTG -3'
(R):5'- CACCAAGCCAGGTCAGAGTTTG -3'
Posted On 2014-06-30