Incidental Mutation 'R1911:Abca7'
ID210287
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene NameATP-binding cassette, sub-family A (ABC1), member 7
SynonymsAbc51
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79996494-80015572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80006634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1134 (V1134A)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect probably benign
Transcript: ENSMUST00000043866
AA Change: V1134A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: V1134A

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132517
AA Change: V1134A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: V1134A

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171637
AA Change: V1134A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: V1134A

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dmxl1 T C 18: 49,878,163 I1129T probably benign Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Elp4 T A 2: 105,702,743 H419L probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mapk8ip3 A C 17: 24,904,051 D610E probably benign Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Muc5ac T C 7: 141,796,304 F595L probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Nod1 C T 6: 54,944,440 V298M probably damaging Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Zfp644 A G 5: 106,635,271 M1079T possibly damaging Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 80011297 missense probably damaging 0.96
IGL01074:Abca7 APN 10 80013892 missense possibly damaging 0.88
IGL01313:Abca7 APN 10 80003123 splice site probably benign
IGL01372:Abca7 APN 10 80006255 missense probably benign 0.00
IGL01387:Abca7 APN 10 79999762 missense possibly damaging 0.71
IGL01468:Abca7 APN 10 80003877 missense probably benign 0.21
IGL01648:Abca7 APN 10 80011080 missense probably damaging 1.00
IGL01796:Abca7 APN 10 80013909 missense probably damaging 0.99
IGL01977:Abca7 APN 10 80006152 missense probably benign 0.31
IGL01982:Abca7 APN 10 80002641 missense probably damaging 1.00
IGL02115:Abca7 APN 10 79998079 missense probably damaging 1.00
IGL02437:Abca7 APN 10 80008389 missense probably damaging 1.00
IGL02721:Abca7 APN 10 80013635 missense possibly damaging 0.93
IGL02812:Abca7 APN 10 80006047 missense possibly damaging 0.84
IGL02823:Abca7 APN 10 80008822 missense probably damaging 1.00
IGL02827:Abca7 APN 10 80009865 missense probably damaging 1.00
IGL02897:Abca7 APN 10 80001592 missense probably damaging 1.00
IGL02952:Abca7 APN 10 80007408 missense probably damaging 1.00
R0507:Abca7 UTSW 10 80002821 splice site probably benign
R0528:Abca7 UTSW 10 80003014 missense probably damaging 1.00
R0541:Abca7 UTSW 10 80007351 missense probably benign 0.01
R0584:Abca7 UTSW 10 80011730 missense probably damaging 1.00
R1018:Abca7 UTSW 10 80001491 missense probably damaging 1.00
R1099:Abca7 UTSW 10 80013743 nonsense probably null
R1520:Abca7 UTSW 10 80008830 missense possibly damaging 0.69
R1536:Abca7 UTSW 10 80014230 missense probably benign 0.39
R1619:Abca7 UTSW 10 80009055 missense probably damaging 1.00
R1636:Abca7 UTSW 10 80008998 missense probably benign
R1752:Abca7 UTSW 10 80006634 missense probably benign 0.17
R1762:Abca7 UTSW 10 79999765 missense probably damaging 1.00
R1764:Abca7 UTSW 10 80008950 missense probably damaging 1.00
R1891:Abca7 UTSW 10 80005040 missense possibly damaging 0.72
R2032:Abca7 UTSW 10 80008237 missense probably damaging 1.00
R2188:Abca7 UTSW 10 80002533 missense probably damaging 1.00
R2973:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R2974:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R3055:Abca7 UTSW 10 79999747 missense probably damaging 1.00
R4496:Abca7 UTSW 10 80002934 missense probably damaging 1.00
R4570:Abca7 UTSW 10 80006694 missense probably damaging 1.00
R4581:Abca7 UTSW 10 80006568 missense probably benign 0.03
R4588:Abca7 UTSW 10 79997867 splice site probably null
R4628:Abca7 UTSW 10 80015188 critical splice donor site probably null
R4641:Abca7 UTSW 10 80005781 critical splice donor site probably null
R4888:Abca7 UTSW 10 80002728 missense probably damaging 0.97
R4911:Abca7 UTSW 10 80012188 critical splice donor site probably null
R4979:Abca7 UTSW 10 80004783 nonsense probably null
R4997:Abca7 UTSW 10 80007320 missense possibly damaging 0.90
R5147:Abca7 UTSW 10 80015315 missense probably benign 0.02
R5176:Abca7 UTSW 10 79998289 missense probably benign 0.35
R5190:Abca7 UTSW 10 79999593 critical splice donor site probably null
R5358:Abca7 UTSW 10 80013331 missense probably damaging 0.99
R5409:Abca7 UTSW 10 80014320 missense probably damaging 1.00
R5705:Abca7 UTSW 10 80015442 missense probably benign
R6246:Abca7 UTSW 10 80015165 missense probably damaging 1.00
R6256:Abca7 UTSW 10 80002622 missense probably damaging 1.00
R6260:Abca7 UTSW 10 80008987 missense probably damaging 1.00
R6275:Abca7 UTSW 10 79997791 missense probably damaging 1.00
R6277:Abca7 UTSW 10 80006158 missense probably benign 0.04
R6284:Abca7 UTSW 10 80004410 missense probably benign
R6307:Abca7 UTSW 10 80007387 missense probably damaging 1.00
R6451:Abca7 UTSW 10 80006899 missense probably damaging 0.99
R6456:Abca7 UTSW 10 80015150 missense probably null 0.69
R6460:Abca7 UTSW 10 80009028 missense probably benign 0.04
R6560:Abca7 UTSW 10 80007396 missense probably damaging 1.00
R6565:Abca7 UTSW 10 80011788 missense probably damaging 1.00
R6644:Abca7 UTSW 10 80008764 missense probably damaging 0.98
R6814:Abca7 UTSW 10 80002999 missense probably damaging 1.00
R7289:Abca7 UTSW 10 80009944 missense probably damaging 1.00
R7303:Abca7 UTSW 10 80014988 missense probably benign 0.17
R7493:Abca7 UTSW 10 80002062 missense probably damaging 0.96
R7535:Abca7 UTSW 10 80001629 missense probably benign 0.04
R7602:Abca7 UTSW 10 79998012 critical splice acceptor site probably null
R7607:Abca7 UTSW 10 80011833 missense probably damaging 1.00
R7647:Abca7 UTSW 10 80000822 missense probably benign 0.00
R7821:Abca7 UTSW 10 80002590 small deletion probably benign
R7863:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7896:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7911:Abca7 UTSW 10 80005033 missense probably benign 0.00
R7946:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7979:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7992:Abca7 UTSW 10 80005033 missense probably benign 0.00
Z1176:Abca7 UTSW 10 79999432 nonsense probably null
Z1176:Abca7 UTSW 10 80006559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACACGAGGAACCTCAG -3'
(R):5'- TACACCATTGGTCCTCACAGAC -3'

Sequencing Primer
(F):5'- CGAGGAACCTCAGACAAGAGC -3'
(R):5'- TCAAGAGACTTCCAAGCAGTC -3'
Posted On2014-06-30