Mutagenetix > Incidental Mutation

Incidental Mutation 'R1911:Psme4'

210291

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

039929-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1911 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 30815658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 587 (S587A)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: S587A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: S587A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133430

Meta Mutation Damage Score

0.0718

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.2%

Validation Efficiency

99% (99/100)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
4930590J08Rik	T	A	6: 91,950,069		probably benign	Het
5430419D17Rik	T	C	7: 131,238,089	V580A	probably damaging	Het
Abca7	T	C	10: 80,006,634	V1134A	probably benign	Het
Acaa2	A	G	18: 74,792,412	E82G	probably benign	Het
Acap1	T	C	11: 69,881,722	D521G	probably damaging	Het
Adam19	T	C	11: 46,121,454	V259A	probably damaging	Het
Adssl1	T	C	12: 112,633,009	V140A	probably benign	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Ank1	T	C	8: 23,099,650	V589A	probably damaging	Het
Ano2	G	A	6: 126,013,691	D803N	probably benign	Het
Arid1b	A	G	17: 5,342,966	E2257G	probably damaging	Het
Asb17	T	C	3: 153,844,501	Y57H	probably benign	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Aspm	T	A	1: 139,478,094	I1573K	probably benign	Het
Bcas1	C	A	2: 170,387,943	D236Y	probably damaging	Het
Bcas2	G	T	3: 103,171,797	G9*	probably null	Het
Btaf1	A	G	19: 36,986,630	Q867R	probably benign	Het
C87499	T	C	4: 88,630,072	Q32R	possibly damaging	Het
Calhm3	C	T	19: 47,155,469	V132I	possibly damaging	Het
Ccer1	A	T	10: 97,694,677	I401F	possibly damaging	Het
Cecr2	T	A	6: 120,762,565		probably benign	Het
Cep104	G	A	4: 154,006,798	R925Q	possibly damaging	Het
Cep164	T	A	9: 45,770,806	M1900L	probably benign	Het
Crybg1	A	G	10: 43,997,677	V1145A	possibly damaging	Het
Cyp2a4	T	A	7: 26,308,974	N180K	possibly damaging	Het
Dennd4a	T	C	9: 64,889,086	L798P	probably damaging	Het
Dmxl1	T	C	18: 49,878,163	I1129T	probably benign	Het
Dnah2	T	C	11: 69,515,752	N555D	possibly damaging	Het
Dock1	T	A	7: 134,999,300	M988K	probably damaging	Het
Elp4	T	A	2: 105,702,743	H419L	probably damaging	Het
Endov	T	C	11: 119,502,351	V109A	possibly damaging	Het
Epha8	T	C	4: 136,936,314	Y477C	probably damaging	Het
Erlin1	A	G	19: 44,049,122	M188T	probably damaging	Het
Fam160a1	T	A	3: 85,661,218	D998V	probably benign	Het
Fhod3	A	T	18: 25,112,586	D1231V	possibly damaging	Het
Gimap3	T	A	6: 48,765,712	I95F	possibly damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Grk1	C	A	8: 13,407,923	D274E	probably damaging	Het
Gsdmc2	G	A	15: 63,827,772	A269V	probably benign	Het
Krt33a	T	A	11: 100,012,349	Q289L	probably benign	Het
Krt76	T	A	15: 101,888,165	K403*	probably null	Het
Lcn4	T	C	2: 26,670,595		probably benign	Het
Mab21l1	T	C	3: 55,783,627	S212P	possibly damaging	Het
Mapk8ip3	A	C	17: 24,904,051	D610E	probably benign	Het
Mastl	G	T	2: 23,132,680	S677*	probably null	Het
Mfap3	T	C	11: 57,529,736	F181S	probably damaging	Het
Mlkl	T	C	8: 111,312,100		probably benign	Het
Mov10	G	A	3: 104,801,560		probably benign	Het
Muc5ac	T	C	7: 141,796,304	F595L	probably benign	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nit2	G	A	16: 57,161,683		probably benign	Het
Nod1	C	T	6: 54,944,440	V298M	probably damaging	Het
Olfr1216	A	G	2: 89,013,221	L281P	probably damaging	Het
Olfr399	C	A	11: 74,054,384	R125L	probably damaging	Het
Olfr690	T	A	7: 105,329,383	I270F	probably benign	Het
Olfr800	A	T	10: 129,660,112	D102V	probably benign	Het
Olfr834	T	C	9: 18,988,900	L304P	probably damaging	Het
Osbpl5	C	A	7: 143,689,925	R864L	probably benign	Het
Pcnt	G	A	10: 76,368,816	T2585M	possibly damaging	Het
Pepd	C	T	7: 34,934,749		probably benign	Het
Pou6f2	T	C	13: 18,151,963	I341V	probably damaging	Het
Prune2	T	A	19: 17,113,674	F281I	probably benign	Het
Psg19	T	G	7: 18,794,268	Q183H	probably damaging	Het
Ptpro	T	C	6: 137,400,619		probably benign	Het
Rasgrp4	T	C	7: 29,138,877	V92A	probably damaging	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rexo5	C	T	7: 119,799,644	A68V	probably damaging	Het
Robo2	A	T	16: 73,958,325	N769K	probably damaging	Het
Sfrp5	C	T	19: 42,198,798	V278I	probably benign	Het
Sidt1	A	G	16: 44,281,871	S309P	possibly damaging	Het
Slc22a6	A	C	19: 8,621,882	Q292H	probably benign	Het
Slc4a3	G	A	1: 75,553,723	R690H	probably damaging	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Spag6	T	A	2: 18,715,805	Y129*	probably null	Het
Srcap	T	C	7: 127,534,822	I905T	probably damaging	Het
St6gal1	T	G	16: 23,321,633	S185A	probably damaging	Het
Sult6b1	G	A	17: 78,888,964	H250Y	possibly damaging	Het
Tdrd6	T	G	17: 43,627,088	N1023T	probably benign	Het
Tecta	C	T	9: 42,337,936	E1877K	probably damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tex14	T	A	11: 87,495,035	D240E	probably damaging	Het
Tex47	T	C	5: 7,305,022	Y68H	probably damaging	Het
Thbs2	A	G	17: 14,689,842	V165A	probably benign	Het
Tmem126b	T	A	7: 90,469,159	Y171F	possibly damaging	Het
Tpsg1	G	T	17: 25,373,400	M46I	probably benign	Het
Trmt2a	A	G	16: 18,251,206	K304R	probably benign	Het
Ttc28	G	T	5: 111,280,750	R1845L	possibly damaging	Het
Umodl1	A	T	17: 30,992,154	T884S	possibly damaging	Het
Vmn2r77	A	G	7: 86,811,793	K776E	probably damaging	Het
Vmn2r88	T	C	14: 51,418,214	S627P	probably damaging	Het
Vrk1	T	C	12: 106,057,977		probably null	Het
Zfp644	A	G	5: 106,635,271	M1079T	possibly damaging	Het
Znrf1	T	C	8: 111,621,601	*41Q	probably null	Het
Znrf1	T	C	8: 111,621,612	F183L	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTAAGGTTGGTACTGTGAAG -3'
(R):5'- TGCAGACACATTTCAATGAGGATG -3'

Sequencing Primer
(F):5'- GGTTGGTACTGTGAAGTCTATTTATG -3'
(R):5'- CACATTTCAATGAGGATGAACAACG -3'

Posted On

2014-06-30