Mutagenetix > Incidental Mutations

Incidental Mutation 'R1911:Dnah2'

210294

Institutional Source

Beutler Lab

Gene Symbol

Dnah2

Ensembl Gene

ENSMUSG00000005237

Gene Name

dynein, axonemal, heavy chain 2

Synonyms

Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik

MMRRC Submission

039929-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1911 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69420809-69549110 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69515752 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 555 (N555D)

Ref Sequence

ENSEMBL: ENSMUSP00000104299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659] [ENSMUST00000208777]

Predicted Effect

probably benign
Transcript: ENSMUST00000035539
AA Change: N555D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: N555D

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	273	429	6.6e-37	PFAM
Pfam:DHC_N1	432	761	1.3e-54	PFAM
Pfam:DHC_N2	1253	1668	3.4e-144	PFAM
AAA	1826	1962	2.95e-1	SMART
Pfam:AAA_5	2108	2251	1.3e-5	PFAM
AAA	2437	2584	3.63e-5	SMART
Pfam:AAA_8	2752	3022	1.1e-75	PFAM
Pfam:MT	3034	3370	8.7e-55	PFAM
Pfam:AAA_9	3386	3616	7.4e-68	PFAM
Pfam:Dynein_heavy	3748	4453	1.2e-220	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108659
AA Change: N555D

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: N555D

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	274	429	1.1e-47	PFAM
Pfam:DHC_N1	438	760	1.5e-75	PFAM
Pfam:DHC_N2	1255	1666	4.4e-144	PFAM
low complexity region	1711	1720	N/A	INTRINSIC
AAA	1832	1968	2.95e-1	SMART
Blast:AAA	2111	2251	2e-86	BLAST
AAA	2443	2590	3.63e-5	SMART
Pfam:AAA_8	2758	3028	5.5e-77	PFAM
Pfam:MT	3040	3376	7.6e-55	PFAM
Pfam:AAA_9	3396	3621	7.5e-94	PFAM
Pfam:Dynein_heavy	3759	4458	4.9e-264	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149991

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154985

Predicted Effect

probably benign
Transcript: ENSMUST00000208777

Meta Mutation Damage Score

0.2938

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.2%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
4930590J08Rik	T	A	6: 91,950,069		probably benign	Het
5430419D17Rik	T	C	7: 131,238,089	V580A	probably damaging	Het
Abca7	T	C	10: 80,006,634	V1134A	probably benign	Het
Acaa2	A	G	18: 74,792,412	E82G	probably benign	Het
Acap1	T	C	11: 69,881,722	D521G	probably damaging	Het
Adam19	T	C	11: 46,121,454	V259A	probably damaging	Het
Adssl1	T	C	12: 112,633,009	V140A	probably benign	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Ank1	T	C	8: 23,099,650	V589A	probably damaging	Het
Ano2	G	A	6: 126,013,691	D803N	probably benign	Het
Arid1b	A	G	17: 5,342,966	E2257G	probably damaging	Het
Asb17	T	C	3: 153,844,501	Y57H	probably benign	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Aspm	T	A	1: 139,478,094	I1573K	probably benign	Het
Bcas1	C	A	2: 170,387,943	D236Y	probably damaging	Het
Bcas2	G	T	3: 103,171,797	G9*	probably null	Het
Btaf1	A	G	19: 36,986,630	Q867R	probably benign	Het
C87499	T	C	4: 88,630,072	Q32R	possibly damaging	Het
Calhm3	C	T	19: 47,155,469	V132I	possibly damaging	Het
Ccer1	A	T	10: 97,694,677	I401F	possibly damaging	Het
Cecr2	T	A	6: 120,762,565		probably benign	Het
Cep104	G	A	4: 154,006,798	R925Q	possibly damaging	Het
Cep164	T	A	9: 45,770,806	M1900L	probably benign	Het
Crybg1	A	G	10: 43,997,677	V1145A	possibly damaging	Het
Cyp2a4	T	A	7: 26,308,974	N180K	possibly damaging	Het
Dennd4a	T	C	9: 64,889,086	L798P	probably damaging	Het
Dmxl1	T	C	18: 49,878,163	I1129T	probably benign	Het
Dock1	T	A	7: 134,999,300	M988K	probably damaging	Het
Elp4	T	A	2: 105,702,743	H419L	probably damaging	Het
Endov	T	C	11: 119,502,351	V109A	possibly damaging	Het
Epha8	T	C	4: 136,936,314	Y477C	probably damaging	Het
Erlin1	A	G	19: 44,049,122	M188T	probably damaging	Het
Fam160a1	T	A	3: 85,661,218	D998V	probably benign	Het
Fhod3	A	T	18: 25,112,586	D1231V	possibly damaging	Het
Gimap3	T	A	6: 48,765,712	I95F	possibly damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Grk1	C	A	8: 13,407,923	D274E	probably damaging	Het
Gsdmc2	G	A	15: 63,827,772	A269V	probably benign	Het
Krt33a	T	A	11: 100,012,349	Q289L	probably benign	Het
Krt76	T	A	15: 101,888,165	K403*	probably null	Het
Lcn4	T	C	2: 26,670,595		probably benign	Het
Mab21l1	T	C	3: 55,783,627	S212P	possibly damaging	Het
Mapk8ip3	A	C	17: 24,904,051	D610E	probably benign	Het
Mastl	G	T	2: 23,132,680	S677*	probably null	Het
Mfap3	T	C	11: 57,529,736	F181S	probably damaging	Het
Mlkl	T	C	8: 111,312,100		probably benign	Het
Mov10	G	A	3: 104,801,560		probably benign	Het
Muc5ac	T	C	7: 141,796,304	F595L	probably benign	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nit2	G	A	16: 57,161,683		probably benign	Het
Nod1	C	T	6: 54,944,440	V298M	probably damaging	Het
Olfr1216	A	G	2: 89,013,221	L281P	probably damaging	Het
Olfr399	C	A	11: 74,054,384	R125L	probably damaging	Het
Olfr690	T	A	7: 105,329,383	I270F	probably benign	Het
Olfr800	A	T	10: 129,660,112	D102V	probably benign	Het
Olfr834	T	C	9: 18,988,900	L304P	probably damaging	Het
Osbpl5	C	A	7: 143,689,925	R864L	probably benign	Het
Pcnt	G	A	10: 76,368,816	T2585M	possibly damaging	Het
Pepd	C	T	7: 34,934,749		probably benign	Het
Pou6f2	T	C	13: 18,151,963	I341V	probably damaging	Het
Prune2	T	A	19: 17,113,674	F281I	probably benign	Het
Psg19	T	G	7: 18,794,268	Q183H	probably damaging	Het
Psme4	T	G	11: 30,815,658	S587A	probably benign	Het
Ptpro	T	C	6: 137,400,619		probably benign	Het
Rasgrp4	T	C	7: 29,138,877	V92A	probably damaging	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rexo5	C	T	7: 119,799,644	A68V	probably damaging	Het
Robo2	A	T	16: 73,958,325	N769K	probably damaging	Het
Sfrp5	C	T	19: 42,198,798	V278I	probably benign	Het
Sidt1	A	G	16: 44,281,871	S309P	possibly damaging	Het
Slc22a6	A	C	19: 8,621,882	Q292H	probably benign	Het
Slc4a3	G	A	1: 75,553,723	R690H	probably damaging	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Spag6	T	A	2: 18,715,805	Y129*	probably null	Het
Srcap	T	C	7: 127,534,822	I905T	probably damaging	Het
St6gal1	T	G	16: 23,321,633	S185A	probably damaging	Het
Sult6b1	G	A	17: 78,888,964	H250Y	possibly damaging	Het
Tdrd6	T	G	17: 43,627,088	N1023T	probably benign	Het
Tecta	C	T	9: 42,337,936	E1877K	probably damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tex14	T	A	11: 87,495,035	D240E	probably damaging	Het
Tex47	T	C	5: 7,305,022	Y68H	probably damaging	Het
Thbs2	A	G	17: 14,689,842	V165A	probably benign	Het
Tmem126b	T	A	7: 90,469,159	Y171F	possibly damaging	Het
Tpsg1	G	T	17: 25,373,400	M46I	probably benign	Het
Trmt2a	A	G	16: 18,251,206	K304R	probably benign	Het
Ttc28	G	T	5: 111,280,750	R1845L	possibly damaging	Het
Umodl1	A	T	17: 30,992,154	T884S	possibly damaging	Het
Vmn2r77	A	G	7: 86,811,793	K776E	probably damaging	Het
Vmn2r88	T	C	14: 51,418,214	S627P	probably damaging	Het
Vrk1	T	C	12: 106,057,977		probably null	Het
Zfp644	A	G	5: 106,635,271	M1079T	possibly damaging	Het
Znrf1	T	C	8: 111,621,612	F183L	possibly damaging	Het
Znrf1	T	C	8: 111,621,601	*41Q	probably null	Het

Other mutations in Dnah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dnah2	APN	11	69492672	missense	possibly damaging	0.93
IGL00418:Dnah2	APN	11	69495066	splice site	probably benign
IGL00772:Dnah2	APN	11	69451257	missense	probably damaging	0.97
IGL00819:Dnah2	APN	11	69473350	critical splice donor site	probably null
IGL00827:Dnah2	APN	11	69448457	missense	probably damaging	1.00
IGL01060:Dnah2	APN	11	69478092	missense	possibly damaging	0.86
IGL01340:Dnah2	APN	11	69493184	missense	probably damaging	0.99
IGL01349:Dnah2	APN	11	69475606	missense	probably damaging	0.99
IGL01413:Dnah2	APN	11	69432964	missense	probably damaging	0.99
IGL01451:Dnah2	APN	11	69474191	splice site	probably benign
IGL01480:Dnah2	APN	11	69458371	missense	possibly damaging	0.91
IGL01537:Dnah2	APN	11	69516080	missense	probably benign	0.17
IGL01592:Dnah2	APN	11	69431087	missense	probably benign	0.14
IGL01612:Dnah2	APN	11	69465063	splice site	probably benign
IGL01667:Dnah2	APN	11	69544395	missense	probably benign
IGL01667:Dnah2	APN	11	69520941	missense	probably damaging	0.98
IGL01691:Dnah2	APN	11	69539443	missense	probably benign
IGL02019:Dnah2	APN	11	69474285	missense	probably damaging	1.00
IGL02039:Dnah2	APN	11	69499212	missense	probably damaging	1.00
IGL02076:Dnah2	APN	11	69422559	missense	probably damaging	0.99
IGL02085:Dnah2	APN	11	69458185	missense	probably benign	0.07
IGL02158:Dnah2	APN	11	69458123	missense	probably benign
IGL02381:Dnah2	APN	11	69446292	missense	probably benign	0.25
IGL02681:Dnah2	APN	11	69452933	missense	probably benign	0.40
IGL02957:Dnah2	APN	11	69448507	missense	possibly damaging	0.96
IGL02961:Dnah2	APN	11	69518414	missense	probably damaging	1.00
IGL02969:Dnah2	APN	11	69521187	missense	possibly damaging	0.80
IGL03117:Dnah2	APN	11	69436291	splice site	probably benign
IGL03120:Dnah2	APN	11	69421848	missense	probably damaging	1.00
IGL03183:Dnah2	APN	11	69458488	missense	possibly damaging	0.94
IGL03197:Dnah2	APN	11	69459263	missense	probably damaging	1.00
IGL03263:Dnah2	APN	11	69529381	critical splice donor site	probably null
IGL03333:Dnah2	APN	11	69495123	missense	probably damaging	1.00
IGL03338:Dnah2	APN	11	69496577	missense	probably benign	0.13
argyrios	UTSW	11	69516590	missense	possibly damaging	0.47
Aureus	UTSW	11	69429348	missense	probably damaging	1.00
platinum	UTSW	11	69458042	missense	probably damaging	0.96
BB005:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
BB015:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
E0370:Dnah2	UTSW	11	69515615	splice site	probably null
P0026:Dnah2	UTSW	11	69464947	missense	probably damaging	1.00
R0133:Dnah2	UTSW	11	69421009	missense	probably damaging	1.00
R0190:Dnah2	UTSW	11	69435249	missense	probably damaging	1.00
R0334:Dnah2	UTSW	11	69436836	missense	probably damaging	1.00
R0359:Dnah2	UTSW	11	69529531	missense	probably benign	0.00
R0386:Dnah2	UTSW	11	69447861	missense	probably damaging	1.00
R0414:Dnah2	UTSW	11	69499238	missense	probably benign	0.26
R0427:Dnah2	UTSW	11	69452879	missense	probably damaging	0.99
R0433:Dnah2	UTSW	11	69459288	missense	probably damaging	1.00
R0442:Dnah2	UTSW	11	69448542	missense	probably damaging	1.00
R0462:Dnah2	UTSW	11	69459201	missense	probably damaging	1.00
R0463:Dnah2	UTSW	11	69423126	missense	probably damaging	1.00
R0611:Dnah2	UTSW	11	69499194	missense	probably damaging	1.00
R0626:Dnah2	UTSW	11	69477683	missense	probably benign	0.07
R0924:Dnah2	UTSW	11	69421308	missense	probably damaging	1.00
R0968:Dnah2	UTSW	11	69448519	missense	possibly damaging	0.67
R1066:Dnah2	UTSW	11	69447819	missense	probably damaging	1.00
R1183:Dnah2	UTSW	11	69446648	missense	possibly damaging	0.95
R1184:Dnah2	UTSW	11	69499190	missense	probably damaging	1.00
R1186:Dnah2	UTSW	11	69515700	missense	probably damaging	0.99
R1453:Dnah2	UTSW	11	69451050	missense	probably damaging	0.99
R1498:Dnah2	UTSW	11	69520667	splice site	probably null
R1538:Dnah2	UTSW	11	69477202	missense	probably benign	0.17
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1590:Dnah2	UTSW	11	69422754	critical splice donor site	probably null
R1590:Dnah2	UTSW	11	69521198	missense	probably benign	0.00
R1655:Dnah2	UTSW	11	69473854	missense	probably damaging	1.00
R1695:Dnah2	UTSW	11	69514691	missense	possibly damaging	0.74
R1726:Dnah2	UTSW	11	69497889	missense	probably damaging	1.00
R1764:Dnah2	UTSW	11	69423543	missense	probably damaging	1.00
R1815:Dnah2	UTSW	11	69475574	missense	probably damaging	1.00
R1822:Dnah2	UTSW	11	69514804	missense	probably damaging	1.00
R1859:Dnah2	UTSW	11	69437886	missense	probably damaging	0.99
R1913:Dnah2	UTSW	11	69464930	missense	probably damaging	1.00
R1981:Dnah2	UTSW	11	69474325	missense	probably damaging	1.00
R2010:Dnah2	UTSW	11	69458358	critical splice donor site	probably null
R2016:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2017:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2044:Dnah2	UTSW	11	69524240	missense	probably benign	0.14
R2077:Dnah2	UTSW	11	69496606	missense	possibly damaging	0.73
R2096:Dnah2	UTSW	11	69455916	missense	probably damaging	0.98
R2099:Dnah2	UTSW	11	69493237	missense	probably damaging	1.00
R2127:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2128:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2146:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2147:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2150:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2404:Dnah2	UTSW	11	69437221	missense	probably damaging	0.99
R2510:Dnah2	UTSW	11	69524206	nonsense	probably null
R2517:Dnah2	UTSW	11	69516644	missense	probably damaging	1.00
R3014:Dnah2	UTSW	11	69430478	missense	probably benign
R3741:Dnah2	UTSW	11	69448469	missense	probably damaging	1.00
R3814:Dnah2	UTSW	11	69492650	splice site	probably null
R3872:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3873:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3874:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3875:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3881:Dnah2	UTSW	11	69451347	missense	possibly damaging	0.94
R3953:Dnah2	UTSW	11	69454103	missense	probably damaging	1.00
R3956:Dnah2	UTSW	11	69484021	missense	probably benign	0.00
R4501:Dnah2	UTSW	11	69477659	missense	probably benign
R4515:Dnah2	UTSW	11	69465631	missense	possibly damaging	0.61
R4612:Dnah2	UTSW	11	69483367	missense	possibly damaging	0.93
R4625:Dnah2	UTSW	11	69463661	missense	probably damaging	1.00
R4627:Dnah2	UTSW	11	69465376	missense	probably damaging	1.00
R4642:Dnah2	UTSW	11	69496559	missense	probably benign	0.00
R4683:Dnah2	UTSW	11	69458942	missense	probably damaging	1.00
R4698:Dnah2	UTSW	11	69498532	missense	probably damaging	1.00
R4710:Dnah2	UTSW	11	69478077	missense	probably damaging	1.00
R4712:Dnah2	UTSW	11	69516590	missense	possibly damaging	0.47
R4713:Dnah2	UTSW	11	69476688	missense	probably damaging	1.00
R4717:Dnah2	UTSW	11	69429357	missense	probably benign	0.00
R4740:Dnah2	UTSW	11	69458042	missense	probably damaging	0.96
R4780:Dnah2	UTSW	11	69473871	missense	probably damaging	0.97
R4825:Dnah2	UTSW	11	69423205	missense	probably damaging	1.00
R4864:Dnah2	UTSW	11	69422590	missense	probably damaging	0.98
R4868:Dnah2	UTSW	11	69463648	missense	probably damaging	1.00
R4879:Dnah2	UTSW	11	69476691	missense	probably damaging	1.00
R4908:Dnah2	UTSW	11	69521147	missense	probably benign	0.00
R4911:Dnah2	UTSW	11	69499104	critical splice donor site	probably null
R4954:Dnah2	UTSW	11	69539496	missense	possibly damaging	0.61
R4962:Dnah2	UTSW	11	69455973	nonsense	probably null
R5015:Dnah2	UTSW	11	69497882	missense	possibly damaging	0.89
R5049:Dnah2	UTSW	11	69448166	missense	probably damaging	1.00
R5055:Dnah2	UTSW	11	69520773	missense	possibly damaging	0.67
R5153:Dnah2	UTSW	11	69520933	missense	possibly damaging	0.84
R5155:Dnah2	UTSW	11	69422536	missense	probably damaging	1.00
R5186:Dnah2	UTSW	11	69435884	missense	probably damaging	1.00
R5187:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5208:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5252:Dnah2	UTSW	11	69529469	missense	probably damaging	0.98
R5296:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5298:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5299:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5301:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5324:Dnah2	UTSW	11	69457993	missense	probably benign	0.07
R5350:Dnah2	UTSW	11	69516036	missense	possibly damaging	0.48
R5377:Dnah2	UTSW	11	69421848	missense	probably damaging	1.00
R5393:Dnah2	UTSW	11	69500857	missense	probably benign
R5421:Dnah2	UTSW	11	69435636	missense	probably damaging	1.00
R5452:Dnah2	UTSW	11	69524383	missense	probably damaging	1.00
R5461:Dnah2	UTSW	11	69473351	critical splice donor site	probably null
R5474:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5476:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5477:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5510:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5527:Dnah2	UTSW	11	69437188	nonsense	probably null
R5566:Dnah2	UTSW	11	69516569	nonsense	probably null
R5587:Dnah2	UTSW	11	69437242	missense	probably damaging	1.00
R5628:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5688:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5690:Dnah2	UTSW	11	69491544	missense	probably benign	0.15
R5711:Dnah2	UTSW	11	69435390	missense	probably damaging	1.00
R5735:Dnah2	UTSW	11	69430817	missense	possibly damaging	0.93
R5826:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5913:Dnah2	UTSW	11	69448430	missense	probably damaging	1.00
R5914:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5960:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5961:Dnah2	UTSW	11	69431148	missense	probably damaging	1.00
R5961:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5977:Dnah2	UTSW	11	69520881	missense	possibly damaging	0.79
R6020:Dnah2	UTSW	11	69500839	missense	probably benign
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6050:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6086:Dnah2	UTSW	11	69516008	missense	probably benign	0.30
R6115:Dnah2	UTSW	11	69446649	missense	probably damaging	1.00
R6123:Dnah2	UTSW	11	69518359	missense	probably benign	0.29
R6159:Dnah2	UTSW	11	69458542	missense	probably damaging	1.00
R6159:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6163:Dnah2	UTSW	11	69520903	nonsense	probably null
R6171:Dnah2	UTSW	11	69423042	missense	probably damaging	1.00
R6263:Dnah2	UTSW	11	69457412	missense	probably damaging	1.00
R6298:Dnah2	UTSW	11	69491641	missense	probably benign	0.25
R6352:Dnah2	UTSW	11	69448227	missense	probably damaging	1.00
R6399:Dnah2	UTSW	11	69458518	missense	probably damaging	0.98
R6466:Dnah2	UTSW	11	69539415	missense	probably benign
R6478:Dnah2	UTSW	11	69516010	missense	probably benign	0.01
R6516:Dnah2	UTSW	11	69465386	missense	probably benign	0.34
R6538:Dnah2	UTSW	11	69437197	missense	possibly damaging	0.87
R6802:Dnah2	UTSW	11	69423690	missense	probably damaging	1.00
R6861:Dnah2	UTSW	11	69455963	missense	possibly damaging	0.64
R6869:Dnah2	UTSW	11	69429471	missense	probably damaging	1.00
R6894:Dnah2	UTSW	11	69484260	missense	probably benign	0.12
R6935:Dnah2	UTSW	11	69421741	missense	probably damaging	1.00
R7017:Dnah2	UTSW	11	69491547	nonsense	probably null
R7073:Dnah2	UTSW	11	69430492	nonsense	probably null
R7111:Dnah2	UTSW	11	69446753	splice site	probably null
R7125:Dnah2	UTSW	11	69436182	missense	probably damaging	0.99
R7137:Dnah2	UTSW	11	69491555	missense	probably damaging	1.00
R7190:Dnah2	UTSW	11	69549097	splice site	probably null
R7214:Dnah2	UTSW	11	69431109	missense	probably damaging	1.00
R7227:Dnah2	UTSW	11	69421396	missense	probably damaging	0.99
R7238:Dnah2	UTSW	11	69459146	critical splice donor site	probably null
R7256:Dnah2	UTSW	11	69431094	missense	probably damaging	1.00
R7267:Dnah2	UTSW	11	69500817	missense	probably damaging	1.00
R7420:Dnah2	UTSW	11	69478797	missense	possibly damaging	0.94
R7421:Dnah2	UTSW	11	69492805	missense	probably benign	0.25
R7437:Dnah2	UTSW	11	69498627	missense	probably damaging	1.00
R7461:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7473:Dnah2	UTSW	11	69491658	missense	probably damaging	0.99
R7528:Dnah2	UTSW	11	69500796	missense	probably damaging	0.99
R7613:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7615:Dnah2	UTSW	11	69435304	missense	probably damaging	0.99
R7626:Dnah2	UTSW	11	69498685	missense	probably damaging	0.99
R7745:Dnah2	UTSW	11	69451318	nonsense	probably null
R7764:Dnah2	UTSW	11	69458158	missense	probably benign	0.29
R7793:Dnah2	UTSW	11	69495214	missense	probably benign	0.00
R7819:Dnah2	UTSW	11	69516593	missense	probably benign	0.01
R7881:Dnah2	UTSW	11	69431238	missense	probably damaging	1.00
R7900:Dnah2	UTSW	11	69518428	missense	probably damaging	1.00
R7916:Dnah2	UTSW	11	69421148	critical splice acceptor site	probably null
R7921:Dnah2	UTSW	11	69520834	missense	probably benign
R7928:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
R7937:Dnah2	UTSW	11	69517685	nonsense	probably null
R7995:Dnah2	UTSW	11	69520737	missense	possibly damaging	0.77
R8202:Dnah2	UTSW	11	69478823	missense	probably benign	0.00
R8208:Dnah2	UTSW	11	69520852	missense	probably benign	0.05
R8215:Dnah2	UTSW	11	69435367	missense	probably damaging	1.00
R8279:Dnah2	UTSW	11	69475573	missense	probably damaging	1.00
R8338:Dnah2	UTSW	11	69487296	missense	probably damaging	1.00
R8348:Dnah2	UTSW	11	69429447	missense	possibly damaging	0.95
R8405:Dnah2	UTSW	11	69458463	missense	probably damaging	1.00
R8407:Dnah2	UTSW	11	69459278	missense	probably benign	0.00
R8493:Dnah2	UTSW	11	69452978	missense	probably damaging	1.00
RF004:Dnah2	UTSW	11	69437187	missense	probably benign	0.24
U24488:Dnah2	UTSW	11	69483822	missense	probably damaging	0.99
X0021:Dnah2	UTSW	11	69448562	missense	possibly damaging	0.81
Z1088:Dnah2	UTSW	11	69430793	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69421821	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69451120	missense	probably benign
Z1176:Dnah2	UTSW	11	69487054	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69498667	missense	probably benign	0.12
Z1176:Dnah2	UTSW	11	69516481	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69516523	missense	probably damaging	1.00
Z1177:Dnah2	UTSW	11	69463453	missense	possibly damaging	0.63
Z1177:Dnah2	UTSW	11	69544557	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGATGCTGTCTGAACTCAC -3'
(R):5'- GGCTTCCACATCTGCAAAGAG -3'

Sequencing Primer
(F):5'- CGTACACTTGGTGTTCACCAAAG -3'
(R):5'- TTCCACATCTGCAAAGAGTGTGC -3'

Posted On

2014-06-30