Incidental Mutation 'R1911:Acap1'
ID 210295
Institutional Source Beutler Lab
Gene Symbol Acap1
Ensembl Gene ENSMUSG00000001588
Gene Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Synonyms Centb1
MMRRC Submission 039929-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1911 (G1)
Quality Score 169
Status Validated
Chromosome 11
Chromosomal Location 69772393-69786365 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69772548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 521 (D521G)
Ref Sequence ENSEMBL: ENSMUSP00000104262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000050555] [ENSMUST00000108622] [ENSMUST00000178597]
AlphaFold Q8K2H4
Predicted Effect probably damaging
Transcript: ENSMUST00000001631
AA Change: D709G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588
AA Change: D709G

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050555
SMART Domains Protein: ENSMUSP00000059107
Gene: ENSMUSG00000046731

DomainStartEndE-ValueType
Pfam:BTB_2 1 73 1.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108622
AA Change: D521G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104262
Gene: ENSMUSG00000001588
AA Change: D521G

DomainStartEndE-ValueType
PH 78 174 4.42e-15 SMART
ArfGap 217 339 2.42e-50 SMART
ANK 418 447 4.01e0 SMART
ANK 451 480 3.04e0 SMART
ANK 484 514 4.18e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127238
Predicted Effect probably benign
Transcript: ENSMUST00000178597
SMART Domains Protein: ENSMUSP00000137492
Gene: ENSMUSG00000094845

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:TMEM95 17 168 3.9e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198919
Meta Mutation Damage Score 0.7848 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,927,050 (GRCm39) probably benign Het
Abca7 T C 10: 79,842,468 (GRCm39) V1134A probably benign Het
Acaa2 A G 18: 74,925,483 (GRCm39) E82G probably benign Het
Adam19 T C 11: 46,012,281 (GRCm39) V259A probably damaging Het
Adss1 T C 12: 112,599,443 (GRCm39) V140A probably benign Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Aldh3b1 T G 19: 3,971,187 (GRCm39) D159A probably damaging Het
Ank1 T C 8: 23,589,666 (GRCm39) V589A probably damaging Het
Ano2 G A 6: 125,990,654 (GRCm39) D803N probably benign Het
Arid1b A G 17: 5,393,241 (GRCm39) E2257G probably damaging Het
Asb17 T C 3: 153,550,138 (GRCm39) Y57H probably benign Het
Asph T C 4: 9,453,335 (GRCm39) E646G probably damaging Het
Aspm T A 1: 139,405,832 (GRCm39) I1573K probably benign Het
Bcas1 C A 2: 170,229,863 (GRCm39) D236Y probably damaging Het
Bcas2 G T 3: 103,079,113 (GRCm39) G9* probably null Het
Btaf1 A G 19: 36,964,030 (GRCm39) Q867R probably benign Het
Calhm3 C T 19: 47,143,908 (GRCm39) V132I possibly damaging Het
Ccer1 A T 10: 97,530,539 (GRCm39) I401F possibly damaging Het
Cdcp3 T C 7: 130,839,818 (GRCm39) V580A probably damaging Het
Cecr2 T A 6: 120,739,526 (GRCm39) probably benign Het
Cep104 G A 4: 154,091,255 (GRCm39) R925Q possibly damaging Het
Cep164 T A 9: 45,682,104 (GRCm39) M1900L probably benign Het
Crybg1 A G 10: 43,873,673 (GRCm39) V1145A possibly damaging Het
Cyp2a4 T A 7: 26,008,399 (GRCm39) N180K possibly damaging Het
Dennd4a T C 9: 64,796,368 (GRCm39) L798P probably damaging Het
Dmxl1 T C 18: 50,011,230 (GRCm39) I1129T probably benign Het
Dnah2 T C 11: 69,406,578 (GRCm39) N555D possibly damaging Het
Dock1 T A 7: 134,601,029 (GRCm39) M988K probably damaging Het
Elp4 T A 2: 105,533,088 (GRCm39) H419L probably damaging Het
Endov T C 11: 119,393,177 (GRCm39) V109A possibly damaging Het
Epha8 T C 4: 136,663,625 (GRCm39) Y477C probably damaging Het
Erlin1 A G 19: 44,037,561 (GRCm39) M188T probably damaging Het
Fhip1a T A 3: 85,568,525 (GRCm39) D998V probably benign Het
Fhod3 A T 18: 25,245,643 (GRCm39) D1231V possibly damaging Het
Gimap3 T A 6: 48,742,646 (GRCm39) I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Grk1 C A 8: 13,457,923 (GRCm39) D274E probably damaging Het
Gsdmc2 G A 15: 63,699,621 (GRCm39) A269V probably benign Het
Krt33a T A 11: 99,903,175 (GRCm39) Q289L probably benign Het
Krt76 T A 15: 101,796,600 (GRCm39) K403* probably null Het
Lcn4 T C 2: 26,560,607 (GRCm39) probably benign Het
Mab21l1 T C 3: 55,691,048 (GRCm39) S212P possibly damaging Het
Mapk8ip3 A C 17: 25,123,025 (GRCm39) D610E probably benign Het
Mastl G T 2: 23,022,692 (GRCm39) S677* probably null Het
Mfap3 T C 11: 57,420,562 (GRCm39) F181S probably damaging Het
Mlkl T C 8: 112,038,732 (GRCm39) probably benign Het
Mov10 G A 3: 104,708,876 (GRCm39) probably benign Het
Muc5ac T C 7: 141,350,041 (GRCm39) F595L probably benign Het
Nbas T A 12: 13,616,145 (GRCm39) C2228S probably benign Het
Nit2 G A 16: 56,982,046 (GRCm39) probably benign Het
Nod1 C T 6: 54,921,425 (GRCm39) V298M probably damaging Het
Or3a4 C A 11: 73,945,210 (GRCm39) R125L probably damaging Het
Or4c111 A G 2: 88,843,565 (GRCm39) L281P probably damaging Het
Or52b1 T A 7: 104,978,590 (GRCm39) I270F probably benign Het
Or6c210 A T 10: 129,495,981 (GRCm39) D102V probably benign Het
Or7g12 T C 9: 18,900,196 (GRCm39) L304P probably damaging Het
Osbpl5 C A 7: 143,243,662 (GRCm39) R864L probably benign Het
Pcnt G A 10: 76,204,650 (GRCm39) T2585M possibly damaging Het
Pepd C T 7: 34,634,174 (GRCm39) probably benign Het
Pou6f2 T C 13: 18,326,548 (GRCm39) I341V probably damaging Het
Pramel32 T C 4: 88,548,309 (GRCm39) Q32R possibly damaging Het
Prune2 T A 19: 17,091,038 (GRCm39) F281I probably benign Het
Psg19 T G 7: 18,528,193 (GRCm39) Q183H probably damaging Het
Psme4 T G 11: 30,765,658 (GRCm39) S587A probably benign Het
Ptpro T C 6: 137,377,617 (GRCm39) probably benign Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rasgrp4 T C 7: 28,838,302 (GRCm39) V92A probably damaging Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Rexo5 C T 7: 119,398,867 (GRCm39) A68V probably damaging Het
Robo2 A T 16: 73,755,213 (GRCm39) N769K probably damaging Het
Sfrp5 C T 19: 42,187,237 (GRCm39) V278I probably benign Het
Sidt1 A G 16: 44,102,234 (GRCm39) S309P possibly damaging Het
Slc22a6 A C 19: 8,599,246 (GRCm39) Q292H probably benign Het
Slc4a3 G A 1: 75,530,367 (GRCm39) R690H probably damaging Het
Snx7 A T 3: 117,623,317 (GRCm39) probably null Het
Spag6 T A 2: 18,720,616 (GRCm39) Y129* probably null Het
Srcap T C 7: 127,133,994 (GRCm39) I905T probably damaging Het
St6gal1 T G 16: 23,140,383 (GRCm39) S185A probably damaging Het
Sult6b1 G A 17: 79,196,393 (GRCm39) H250Y possibly damaging Het
Tdrd6 T G 17: 43,937,979 (GRCm39) N1023T probably benign Het
Tecta C T 9: 42,249,232 (GRCm39) E1877K probably damaging Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tex14 T A 11: 87,385,861 (GRCm39) D240E probably damaging Het
Tex47 T C 5: 7,355,022 (GRCm39) Y68H probably damaging Het
Thbs2 A G 17: 14,910,104 (GRCm39) V165A probably benign Het
Tmem126b T A 7: 90,118,367 (GRCm39) Y171F possibly damaging Het
Tpsg1 G T 17: 25,592,374 (GRCm39) M46I probably benign Het
Trmt2a A G 16: 18,069,070 (GRCm39) K304R probably benign Het
Ttc28 G T 5: 111,428,616 (GRCm39) R1845L possibly damaging Het
Umodl1 A T 17: 31,211,128 (GRCm39) T884S possibly damaging Het
Vmn2r77 A G 7: 86,461,001 (GRCm39) K776E probably damaging Het
Vmn2r88 T C 14: 51,655,671 (GRCm39) S627P probably damaging Het
Vrk1 T C 12: 106,024,236 (GRCm39) probably null Het
Zfp644 A G 5: 106,783,137 (GRCm39) M1079T possibly damaging Het
Znrf1 T C 8: 112,348,233 (GRCm39) *41Q probably null Het
Znrf1 T C 8: 112,348,244 (GRCm39) F183L possibly damaging Het
Other mutations in Acap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Acap1 APN 11 69,773,517 (GRCm39) missense possibly damaging 0.95
IGL01148:Acap1 APN 11 69,781,729 (GRCm39) nonsense probably null
IGL01398:Acap1 APN 11 69,772,548 (GRCm39) missense probably damaging 1.00
IGL01583:Acap1 APN 11 69,772,503 (GRCm39) missense probably damaging 1.00
IGL02002:Acap1 APN 11 69,775,286 (GRCm39) missense probably damaging 1.00
IGL02078:Acap1 APN 11 69,786,112 (GRCm39) missense probably damaging 1.00
IGL02083:Acap1 APN 11 69,780,336 (GRCm39) missense possibly damaging 0.74
IGL02535:Acap1 APN 11 69,773,520 (GRCm39) missense probably benign 0.02
IGL02669:Acap1 APN 11 69,785,421 (GRCm39) unclassified probably benign
IGL03125:Acap1 APN 11 69,777,864 (GRCm39) missense probably damaging 1.00
autobot UTSW 11 69,772,548 (GRCm39) missense probably damaging 1.00
Drone UTSW 11 69,781,297 (GRCm39) missense probably benign 0.21
R0127:Acap1 UTSW 11 69,778,043 (GRCm39) splice site probably benign
R0243:Acap1 UTSW 11 69,776,252 (GRCm39) missense probably damaging 0.98
R0604:Acap1 UTSW 11 69,775,451 (GRCm39) missense probably benign 0.01
R0863:Acap1 UTSW 11 69,777,882 (GRCm39) missense probably damaging 0.98
R1331:Acap1 UTSW 11 69,773,202 (GRCm39) splice site probably null
R1994:Acap1 UTSW 11 69,780,324 (GRCm39) missense probably benign 0.41
R2411:Acap1 UTSW 11 69,776,311 (GRCm39) missense probably damaging 1.00
R2442:Acap1 UTSW 11 69,780,317 (GRCm39) missense possibly damaging 0.46
R2910:Acap1 UTSW 11 69,777,902 (GRCm39) splice site probably benign
R4164:Acap1 UTSW 11 69,780,863 (GRCm39) missense probably benign 0.22
R4223:Acap1 UTSW 11 69,774,511 (GRCm39) missense probably damaging 0.99
R4562:Acap1 UTSW 11 69,776,177 (GRCm39) intron probably benign
R4676:Acap1 UTSW 11 69,780,294 (GRCm39) missense probably benign 0.22
R4852:Acap1 UTSW 11 69,775,202 (GRCm39) missense probably benign 0.30
R4921:Acap1 UTSW 11 69,778,019 (GRCm39) missense probably damaging 0.98
R4928:Acap1 UTSW 11 69,776,641 (GRCm39) missense possibly damaging 0.81
R5536:Acap1 UTSW 11 69,780,133 (GRCm39) missense probably benign 0.11
R5886:Acap1 UTSW 11 69,775,162 (GRCm39) missense probably benign
R6053:Acap1 UTSW 11 69,777,896 (GRCm39) critical splice acceptor site probably null
R6196:Acap1 UTSW 11 69,777,893 (GRCm39) missense probably damaging 0.98
R6220:Acap1 UTSW 11 69,780,505 (GRCm39) missense probably damaging 0.99
R6295:Acap1 UTSW 11 69,781,413 (GRCm39) critical splice donor site probably null
R6333:Acap1 UTSW 11 69,774,427 (GRCm39) missense possibly damaging 0.65
R6414:Acap1 UTSW 11 69,775,162 (GRCm39) missense probably benign
R6848:Acap1 UTSW 11 69,775,487 (GRCm39) missense probably damaging 1.00
R6952:Acap1 UTSW 11 69,776,343 (GRCm39) missense probably benign 0.30
R7243:Acap1 UTSW 11 69,781,297 (GRCm39) missense probably benign 0.21
R8066:Acap1 UTSW 11 69,780,689 (GRCm39) missense probably benign 0.05
R8691:Acap1 UTSW 11 69,781,003 (GRCm39) missense probably damaging 0.99
R8704:Acap1 UTSW 11 69,773,489 (GRCm39) missense possibly damaging 0.49
R9032:Acap1 UTSW 11 69,772,491 (GRCm39) missense probably damaging 1.00
R9233:Acap1 UTSW 11 69,775,484 (GRCm39) missense probably benign 0.00
R9397:Acap1 UTSW 11 69,775,672 (GRCm39) missense probably damaging 1.00
X0012:Acap1 UTSW 11 69,772,515 (GRCm39) missense probably damaging 1.00
X0027:Acap1 UTSW 11 69,772,549 (GRCm39) missense probably damaging 1.00
Z1177:Acap1 UTSW 11 69,773,269 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTGGCGCACAGTAAATG -3'
(R):5'- GTCCATACCGAAATGCCTGACC -3'

Sequencing Primer
(F):5'- TGGCGCACAGTAAATGAACTAAG -3'
(R):5'- GAAATGCCTGACCCCTTAGTAC -3'
Posted On 2014-06-30