Incidental Mutation 'R1911:Mapk8ip3'
ID210316
Institutional Source Beutler Lab
Gene Symbol Mapk8ip3
Ensembl Gene ENSMUSG00000024163
Gene Namemitogen-activated protein kinase 8 interacting protein 3
SynonymsJSAP1, Syd2, JNK-interacting protein 3, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, D17Wsu15e, Jip3, JSAP1a, JSAP1b, JSAP1c, sunday driver 2, JSAP1d, JUN/SAPK-associated protein 1
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.696) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24892153-24936977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24904051 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 610 (D610E)
Ref Sequence ENSEMBL: ENSMUSP00000112712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000119115] [ENSMUST00000120035] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000146923] [ENSMUST00000178969] [ENSMUST00000146706]
Predicted Effect probably benign
Transcript: ENSMUST00000088345
AA Change: D633E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163
AA Change: D633E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115228
AA Change: D618E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163
AA Change: D618E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115229
AA Change: D641E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163
AA Change: D641E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117509
AA Change: D610E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163
AA Change: D610E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119115
AA Change: D601E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163
AA Change: D601E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120035
AA Change: D632E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163
AA Change: D632E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121723
AA Change: D602E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163
AA Change: D602E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121787
AA Change: D596E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163
AA Change: D596E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145357
Predicted Effect probably benign
Transcript: ENSMUST00000146923
AA Change: D633E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163
AA Change: D633E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178969
AA Change: D633E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163
AA Change: D633E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152486
Predicted Effect probably benign
Transcript: ENSMUST00000146706
SMART Domains Protein: ENSMUSP00000118422
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
Pfam:JIP_LZII 203 235 1.6e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the product of Drosophila syd gene, required for the functional interaction of kinesin I with axonal cargo. Studies of the similar gene in mouse suggested that this protein may interact with, and regulate the activity of numerous protein kinases of the JNK signaling pathway, and thus function as a scaffold protein in neuronal cells. The C. elegans counterpart of this gene is found to regulate synaptic vesicle transport possibly by integrating JNK signaling and kinesin-1 transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in impaired lung morphogenesis, causes absence of the telencephalic commissure with multiple defects in brain development and axon guidance, may affect synaptic transmission, and invariably leads to neonatal death due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dmxl1 T C 18: 49,878,163 I1129T probably benign Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Elp4 T A 2: 105,702,743 H419L probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Muc5ac T C 7: 141,796,304 F595L probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Nod1 C T 6: 54,944,440 V298M probably damaging Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Zfp644 A G 5: 106,635,271 M1079T possibly damaging Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Other mutations in Mapk8ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Mapk8ip3 APN 17 24900819 missense probably damaging 1.00
IGL01018:Mapk8ip3 APN 17 24899719 splice site probably benign
IGL01066:Mapk8ip3 APN 17 24901718 missense probably benign 0.00
IGL01656:Mapk8ip3 APN 17 24918029 missense probably damaging 0.99
IGL01991:Mapk8ip3 APN 17 24927861 missense possibly damaging 0.78
IGL02014:Mapk8ip3 APN 17 24903280 splice site probably benign
IGL02219:Mapk8ip3 APN 17 24899558 missense probably damaging 1.00
IGL03006:Mapk8ip3 APN 17 24901515 missense probably benign
ANU74:Mapk8ip3 UTSW 17 24900577 missense possibly damaging 0.94
FR4737:Mapk8ip3 UTSW 17 24902119 splice site probably null
R0028:Mapk8ip3 UTSW 17 24904897 splice site probably benign
R0401:Mapk8ip3 UTSW 17 24909171 intron probably benign
R0496:Mapk8ip3 UTSW 17 24914450 splice site probably benign
R1456:Mapk8ip3 UTSW 17 24906949 missense probably damaging 1.00
R1503:Mapk8ip3 UTSW 17 24904923 missense probably damaging 1.00
R1554:Mapk8ip3 UTSW 17 24903059 missense probably benign 0.14
R1680:Mapk8ip3 UTSW 17 24901011 missense probably damaging 1.00
R1733:Mapk8ip3 UTSW 17 24936850 missense possibly damaging 0.70
R1741:Mapk8ip3 UTSW 17 24899854 missense probably damaging 1.00
R1750:Mapk8ip3 UTSW 17 24914459 missense probably null 1.00
R1774:Mapk8ip3 UTSW 17 24924145 critical splice donor site probably null
R1845:Mapk8ip3 UTSW 17 24914583 missense probably benign 0.29
R1993:Mapk8ip3 UTSW 17 24914588 missense probably damaging 1.00
R2512:Mapk8ip3 UTSW 17 24914703 nonsense probably null
R2656:Mapk8ip3 UTSW 17 24912807 missense probably damaging 1.00
R2990:Mapk8ip3 UTSW 17 24905292 missense probably benign 0.00
R4587:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4617:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4627:Mapk8ip3 UTSW 17 24903293 missense probably benign
R4649:Mapk8ip3 UTSW 17 24904752 missense probably damaging 1.00
R4868:Mapk8ip3 UTSW 17 24901415 missense probably benign 0.04
R4903:Mapk8ip3 UTSW 17 24901209 missense probably benign
R4915:Mapk8ip3 UTSW 17 24909153 missense possibly damaging 0.75
R5447:Mapk8ip3 UTSW 17 24899189 missense probably benign
R5642:Mapk8ip3 UTSW 17 24903311 missense possibly damaging 0.63
R6320:Mapk8ip3 UTSW 17 24906905 missense probably damaging 0.99
R6900:Mapk8ip3 UTSW 17 24909123 splice site probably null
R7178:Mapk8ip3 UTSW 17 24901754 missense probably benign 0.02
R7273:Mapk8ip3 UTSW 17 24906174 missense probably benign 0.00
R7317:Mapk8ip3 UTSW 17 24901718 missense probably benign 0.00
R7323:Mapk8ip3 UTSW 17 24901161 missense probably benign
R7701:Mapk8ip3 UTSW 17 24901404 missense possibly damaging 0.93
R7873:Mapk8ip3 UTSW 17 24906172 missense probably benign 0.01
R8070:Mapk8ip3 UTSW 17 24901104 critical splice donor site probably null
R8314:Mapk8ip3 UTSW 17 24901774 missense probably benign 0.09
R8356:Mapk8ip3 UTSW 17 24904951 missense probably damaging 1.00
R8441:Mapk8ip3 UTSW 17 24920500 intron probably benign
R8537:Mapk8ip3 UTSW 17 24901678 nonsense probably null
R8802:Mapk8ip3 UTSW 17 24905232 missense probably damaging 1.00
R8864:Mapk8ip3 UTSW 17 24899518 missense probably damaging 1.00
R8918:Mapk8ip3 UTSW 17 24912753 missense not run
X0024:Mapk8ip3 UTSW 17 24903973 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGGAAATGGGTGCCTCCTG -3'
(R):5'- GACCTCTTAAGCACAGGATCAC -3'

Sequencing Primer
(F):5'- GGCTCTGCACTACCACTGTG -3'
(R):5'- GGATCACACCCCAGACATAATTGG -3'
Posted On2014-06-30