Incidental Mutation 'R0121:Clec4b2'
ID21032
Institutional Source Beutler Lab
Gene Symbol Clec4b2
Ensembl Gene ENSMUSG00000067767
Gene NameC-type lectin domain family 4, member b2
SynonymsF830043G12Rik, mDCAR1
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location123172893-123204671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123204172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 172 (D172G)
Ref Sequence ENSEMBL: ENSMUSP00000085802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088455]
Predicted Effect probably benign
Transcript: ENSMUST00000088455
AA Change: D172G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000085802
Gene: ENSMUSG00000067767
AA Change: D172G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 79 202 1.87e-33 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Clec4b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Clec4b2 APN 6 123202151 nonsense probably null
IGL01753:Clec4b2 APN 6 123202210 missense possibly damaging 0.90
IGL02168:Clec4b2 APN 6 123204197 missense probably damaging 0.98
IGL02388:Clec4b2 APN 6 123202228 splice site probably null
IGL03194:Clec4b2 APN 6 123200987 missense probably benign 0.07
P0041:Clec4b2 UTSW 6 123181294 missense possibly damaging 0.72
R0013:Clec4b2 UTSW 6 123202149 missense probably damaging 1.00
R0401:Clec4b2 UTSW 6 123181300 nonsense probably null
R1072:Clec4b2 UTSW 6 123204274 missense probably damaging 0.99
R2520:Clec4b2 UTSW 6 123200983 missense probably damaging 1.00
R4575:Clec4b2 UTSW 6 123173680 missense probably damaging 0.99
R4897:Clec4b2 UTSW 6 123201040 nonsense probably null
R4898:Clec4b2 UTSW 6 123204204 missense probably benign 0.36
R5022:Clec4b2 UTSW 6 123200956 missense probably null 1.00
R5023:Clec4b2 UTSW 6 123200956 missense probably null 1.00
R5057:Clec4b2 UTSW 6 123200956 missense probably null 1.00
R5404:Clec4b2 UTSW 6 123181349 missense probably benign 0.06
R5508:Clec4b2 UTSW 6 123173042 start gained probably benign
R6082:Clec4b2 UTSW 6 123204141 critical splice acceptor site probably null
R6333:Clec4b2 UTSW 6 123200678 unclassified probably null
R6902:Clec4b2 UTSW 6 123201028 nonsense probably null
R6946:Clec4b2 UTSW 6 123201028 nonsense probably null
R7144:Clec4b2 UTSW 6 123181384 missense probably benign 0.02
R7709:Clec4b2 UTSW 6 123173015 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCAATGGGTTGAATGTCCCCTGG -3'
(R):5'- GGTGGATAACAATGCAATCCCAAGGC -3'

Sequencing Primer
(F):5'- CTCTGTTATCCAGTGAAATGTGAGC -3'
(R):5'- CCAAGGCCATAAAGGATATGTGATTC -3'
Posted On2013-04-11