Mutagenetix > Incidental Mutation

Incidental Mutation 'R1911:Prune2'

210327

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

039929-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1911 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 17113674 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 281 (F281I)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087689
AA Change: F281I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: F281I

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.2%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
4930590J08Rik	T	A	6: 91,950,069		probably benign	Het
5430419D17Rik	T	C	7: 131,238,089	V580A	probably damaging	Het
Abca7	T	C	10: 80,006,634	V1134A	probably benign	Het
Acaa2	A	G	18: 74,792,412	E82G	probably benign	Het
Acap1	T	C	11: 69,881,722	D521G	probably damaging	Het
Adam19	T	C	11: 46,121,454	V259A	probably damaging	Het
Adssl1	T	C	12: 112,633,009	V140A	probably benign	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Ank1	T	C	8: 23,099,650	V589A	probably damaging	Het
Ano2	G	A	6: 126,013,691	D803N	probably benign	Het
Arid1b	A	G	17: 5,342,966	E2257G	probably damaging	Het
Asb17	T	C	3: 153,844,501	Y57H	probably benign	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Aspm	T	A	1: 139,478,094	I1573K	probably benign	Het
Bcas1	C	A	2: 170,387,943	D236Y	probably damaging	Het
Bcas2	G	T	3: 103,171,797	G9*	probably null	Het
Btaf1	A	G	19: 36,986,630	Q867R	probably benign	Het
C87499	T	C	4: 88,630,072	Q32R	possibly damaging	Het
Calhm3	C	T	19: 47,155,469	V132I	possibly damaging	Het
Ccer1	A	T	10: 97,694,677	I401F	possibly damaging	Het
Cecr2	T	A	6: 120,762,565		probably benign	Het
Cep104	G	A	4: 154,006,798	R925Q	possibly damaging	Het
Cep164	T	A	9: 45,770,806	M1900L	probably benign	Het
Crybg1	A	G	10: 43,997,677	V1145A	possibly damaging	Het
Cyp2a4	T	A	7: 26,308,974	N180K	possibly damaging	Het
Dennd4a	T	C	9: 64,889,086	L798P	probably damaging	Het
Dmxl1	T	C	18: 49,878,163	I1129T	probably benign	Het
Dnah2	T	C	11: 69,515,752	N555D	possibly damaging	Het
Dock1	T	A	7: 134,999,300	M988K	probably damaging	Het
Elp4	T	A	2: 105,702,743	H419L	probably damaging	Het
Endov	T	C	11: 119,502,351	V109A	possibly damaging	Het
Epha8	T	C	4: 136,936,314	Y477C	probably damaging	Het
Erlin1	A	G	19: 44,049,122	M188T	probably damaging	Het
Fam160a1	T	A	3: 85,661,218	D998V	probably benign	Het
Fhod3	A	T	18: 25,112,586	D1231V	possibly damaging	Het
Gimap3	T	A	6: 48,765,712	I95F	possibly damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Grk1	C	A	8: 13,407,923	D274E	probably damaging	Het
Gsdmc2	G	A	15: 63,827,772	A269V	probably benign	Het
Krt33a	T	A	11: 100,012,349	Q289L	probably benign	Het
Krt76	T	A	15: 101,888,165	K403*	probably null	Het
Lcn4	T	C	2: 26,670,595		probably benign	Het
Mab21l1	T	C	3: 55,783,627	S212P	possibly damaging	Het
Mapk8ip3	A	C	17: 24,904,051	D610E	probably benign	Het
Mastl	G	T	2: 23,132,680	S677*	probably null	Het
Mfap3	T	C	11: 57,529,736	F181S	probably damaging	Het
Mlkl	T	C	8: 111,312,100		probably benign	Het
Mov10	G	A	3: 104,801,560		probably benign	Het
Muc5ac	T	C	7: 141,796,304	F595L	probably benign	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nit2	G	A	16: 57,161,683		probably benign	Het
Nod1	C	T	6: 54,944,440	V298M	probably damaging	Het
Olfr1216	A	G	2: 89,013,221	L281P	probably damaging	Het
Olfr399	C	A	11: 74,054,384	R125L	probably damaging	Het
Olfr690	T	A	7: 105,329,383	I270F	probably benign	Het
Olfr800	A	T	10: 129,660,112	D102V	probably benign	Het
Olfr834	T	C	9: 18,988,900	L304P	probably damaging	Het
Osbpl5	C	A	7: 143,689,925	R864L	probably benign	Het
Pcnt	G	A	10: 76,368,816	T2585M	possibly damaging	Het
Pepd	C	T	7: 34,934,749		probably benign	Het
Pou6f2	T	C	13: 18,151,963	I341V	probably damaging	Het
Psg19	T	G	7: 18,794,268	Q183H	probably damaging	Het
Psme4	T	G	11: 30,815,658	S587A	probably benign	Het
Ptpro	T	C	6: 137,400,619		probably benign	Het
Rasgrp4	T	C	7: 29,138,877	V92A	probably damaging	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rexo5	C	T	7: 119,799,644	A68V	probably damaging	Het
Robo2	A	T	16: 73,958,325	N769K	probably damaging	Het
Sfrp5	C	T	19: 42,198,798	V278I	probably benign	Het
Sidt1	A	G	16: 44,281,871	S309P	possibly damaging	Het
Slc22a6	A	C	19: 8,621,882	Q292H	probably benign	Het
Slc4a3	G	A	1: 75,553,723	R690H	probably damaging	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Spag6	T	A	2: 18,715,805	Y129*	probably null	Het
Srcap	T	C	7: 127,534,822	I905T	probably damaging	Het
St6gal1	T	G	16: 23,321,633	S185A	probably damaging	Het
Sult6b1	G	A	17: 78,888,964	H250Y	possibly damaging	Het
Tdrd6	T	G	17: 43,627,088	N1023T	probably benign	Het
Tecta	C	T	9: 42,337,936	E1877K	probably damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tex14	T	A	11: 87,495,035	D240E	probably damaging	Het
Tex47	T	C	5: 7,305,022	Y68H	probably damaging	Het
Thbs2	A	G	17: 14,689,842	V165A	probably benign	Het
Tmem126b	T	A	7: 90,469,159	Y171F	possibly damaging	Het
Tpsg1	G	T	17: 25,373,400	M46I	probably benign	Het
Trmt2a	A	G	16: 18,251,206	K304R	probably benign	Het
Ttc28	G	T	5: 111,280,750	R1845L	possibly damaging	Het
Umodl1	A	T	17: 30,992,154	T884S	possibly damaging	Het
Vmn2r77	A	G	7: 86,811,793	K776E	probably damaging	Het
Vmn2r88	T	C	14: 51,418,214	S627P	probably damaging	Het
Vrk1	T	C	12: 106,057,977		probably null	Het
Zfp644	A	G	5: 106,635,271	M1079T	possibly damaging	Het
Znrf1	T	C	8: 111,621,601	*41Q	probably null	Het
Znrf1	T	C	8: 111,621,612	F183L	possibly damaging	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAATTTACTTCACTTGCCTCTGG -3'
(R):5'- AAACAAGTCCAGTCTCAGGC -3'

Sequencing Primer
(F):5'- TGCCTCTGGTGATAAATACCTG -3'
(R):5'- AGTCTCAGGCAGGACTCTATC -3'

Posted On

2014-06-30