Incidental Mutation 'R1911:Prune2'
ID 210327
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, A330102H22Rik, 6330414G02Rik, Olfaxin
MMRRC Submission 039929-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1911 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 16933482-17201296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 17091038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 281 (F281I)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087689
AA Change: F281I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: F281I

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,927,050 (GRCm39) probably benign Het
Abca7 T C 10: 79,842,468 (GRCm39) V1134A probably benign Het
Acaa2 A G 18: 74,925,483 (GRCm39) E82G probably benign Het
Acap1 T C 11: 69,772,548 (GRCm39) D521G probably damaging Het
Adam19 T C 11: 46,012,281 (GRCm39) V259A probably damaging Het
Adss1 T C 12: 112,599,443 (GRCm39) V140A probably benign Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Aldh3b1 T G 19: 3,971,187 (GRCm39) D159A probably damaging Het
Ank1 T C 8: 23,589,666 (GRCm39) V589A probably damaging Het
Ano2 G A 6: 125,990,654 (GRCm39) D803N probably benign Het
Arid1b A G 17: 5,393,241 (GRCm39) E2257G probably damaging Het
Asb17 T C 3: 153,550,138 (GRCm39) Y57H probably benign Het
Asph T C 4: 9,453,335 (GRCm39) E646G probably damaging Het
Aspm T A 1: 139,405,832 (GRCm39) I1573K probably benign Het
Bcas1 C A 2: 170,229,863 (GRCm39) D236Y probably damaging Het
Bcas2 G T 3: 103,079,113 (GRCm39) G9* probably null Het
Btaf1 A G 19: 36,964,030 (GRCm39) Q867R probably benign Het
Calhm3 C T 19: 47,143,908 (GRCm39) V132I possibly damaging Het
Ccer1 A T 10: 97,530,539 (GRCm39) I401F possibly damaging Het
Cdcp3 T C 7: 130,839,818 (GRCm39) V580A probably damaging Het
Cecr2 T A 6: 120,739,526 (GRCm39) probably benign Het
Cep104 G A 4: 154,091,255 (GRCm39) R925Q possibly damaging Het
Cep164 T A 9: 45,682,104 (GRCm39) M1900L probably benign Het
Crybg1 A G 10: 43,873,673 (GRCm39) V1145A possibly damaging Het
Cyp2a4 T A 7: 26,008,399 (GRCm39) N180K possibly damaging Het
Dennd4a T C 9: 64,796,368 (GRCm39) L798P probably damaging Het
Dmxl1 T C 18: 50,011,230 (GRCm39) I1129T probably benign Het
Dnah2 T C 11: 69,406,578 (GRCm39) N555D possibly damaging Het
Dock1 T A 7: 134,601,029 (GRCm39) M988K probably damaging Het
Elp4 T A 2: 105,533,088 (GRCm39) H419L probably damaging Het
Endov T C 11: 119,393,177 (GRCm39) V109A possibly damaging Het
Epha8 T C 4: 136,663,625 (GRCm39) Y477C probably damaging Het
Erlin1 A G 19: 44,037,561 (GRCm39) M188T probably damaging Het
Fhip1a T A 3: 85,568,525 (GRCm39) D998V probably benign Het
Fhod3 A T 18: 25,245,643 (GRCm39) D1231V possibly damaging Het
Gimap3 T A 6: 48,742,646 (GRCm39) I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Grk1 C A 8: 13,457,923 (GRCm39) D274E probably damaging Het
Gsdmc2 G A 15: 63,699,621 (GRCm39) A269V probably benign Het
Krt33a T A 11: 99,903,175 (GRCm39) Q289L probably benign Het
Krt76 T A 15: 101,796,600 (GRCm39) K403* probably null Het
Lcn4 T C 2: 26,560,607 (GRCm39) probably benign Het
Mab21l1 T C 3: 55,691,048 (GRCm39) S212P possibly damaging Het
Mapk8ip3 A C 17: 25,123,025 (GRCm39) D610E probably benign Het
Mastl G T 2: 23,022,692 (GRCm39) S677* probably null Het
Mfap3 T C 11: 57,420,562 (GRCm39) F181S probably damaging Het
Mlkl T C 8: 112,038,732 (GRCm39) probably benign Het
Mov10 G A 3: 104,708,876 (GRCm39) probably benign Het
Muc5ac T C 7: 141,350,041 (GRCm39) F595L probably benign Het
Nbas T A 12: 13,616,145 (GRCm39) C2228S probably benign Het
Nit2 G A 16: 56,982,046 (GRCm39) probably benign Het
Nod1 C T 6: 54,921,425 (GRCm39) V298M probably damaging Het
Or3a4 C A 11: 73,945,210 (GRCm39) R125L probably damaging Het
Or4c111 A G 2: 88,843,565 (GRCm39) L281P probably damaging Het
Or52b1 T A 7: 104,978,590 (GRCm39) I270F probably benign Het
Or6c210 A T 10: 129,495,981 (GRCm39) D102V probably benign Het
Or7g12 T C 9: 18,900,196 (GRCm39) L304P probably damaging Het
Osbpl5 C A 7: 143,243,662 (GRCm39) R864L probably benign Het
Pcnt G A 10: 76,204,650 (GRCm39) T2585M possibly damaging Het
Pepd C T 7: 34,634,174 (GRCm39) probably benign Het
Pou6f2 T C 13: 18,326,548 (GRCm39) I341V probably damaging Het
Pramel32 T C 4: 88,548,309 (GRCm39) Q32R possibly damaging Het
Psg19 T G 7: 18,528,193 (GRCm39) Q183H probably damaging Het
Psme4 T G 11: 30,765,658 (GRCm39) S587A probably benign Het
Ptpro T C 6: 137,377,617 (GRCm39) probably benign Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rasgrp4 T C 7: 28,838,302 (GRCm39) V92A probably damaging Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Rexo5 C T 7: 119,398,867 (GRCm39) A68V probably damaging Het
Robo2 A T 16: 73,755,213 (GRCm39) N769K probably damaging Het
Sfrp5 C T 19: 42,187,237 (GRCm39) V278I probably benign Het
Sidt1 A G 16: 44,102,234 (GRCm39) S309P possibly damaging Het
Slc22a6 A C 19: 8,599,246 (GRCm39) Q292H probably benign Het
Slc4a3 G A 1: 75,530,367 (GRCm39) R690H probably damaging Het
Snx7 A T 3: 117,623,317 (GRCm39) probably null Het
Spag6 T A 2: 18,720,616 (GRCm39) Y129* probably null Het
Srcap T C 7: 127,133,994 (GRCm39) I905T probably damaging Het
St6gal1 T G 16: 23,140,383 (GRCm39) S185A probably damaging Het
Sult6b1 G A 17: 79,196,393 (GRCm39) H250Y possibly damaging Het
Tdrd6 T G 17: 43,937,979 (GRCm39) N1023T probably benign Het
Tecta C T 9: 42,249,232 (GRCm39) E1877K probably damaging Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tex14 T A 11: 87,385,861 (GRCm39) D240E probably damaging Het
Tex47 T C 5: 7,355,022 (GRCm39) Y68H probably damaging Het
Thbs2 A G 17: 14,910,104 (GRCm39) V165A probably benign Het
Tmem126b T A 7: 90,118,367 (GRCm39) Y171F possibly damaging Het
Tpsg1 G T 17: 25,592,374 (GRCm39) M46I probably benign Het
Trmt2a A G 16: 18,069,070 (GRCm39) K304R probably benign Het
Ttc28 G T 5: 111,428,616 (GRCm39) R1845L possibly damaging Het
Umodl1 A T 17: 31,211,128 (GRCm39) T884S possibly damaging Het
Vmn2r77 A G 7: 86,461,001 (GRCm39) K776E probably damaging Het
Vmn2r88 T C 14: 51,655,671 (GRCm39) S627P probably damaging Het
Vrk1 T C 12: 106,024,236 (GRCm39) probably null Het
Zfp644 A G 5: 106,783,137 (GRCm39) M1079T possibly damaging Het
Znrf1 T C 8: 112,348,233 (GRCm39) *41Q probably null Het
Znrf1 T C 8: 112,348,244 (GRCm39) F183L possibly damaging Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17,145,708 (GRCm39) critical splice donor site probably null
IGL00848:Prune2 APN 19 17,096,482 (GRCm39) missense probably damaging 1.00
IGL00862:Prune2 APN 19 17,096,713 (GRCm39) missense probably benign 0.41
IGL00915:Prune2 APN 19 16,993,617 (GRCm39) missense probably damaging 1.00
IGL01084:Prune2 APN 19 17,095,573 (GRCm39) missense probably benign 0.19
IGL01109:Prune2 APN 19 17,101,243 (GRCm39) missense probably benign 0.03
IGL01372:Prune2 APN 19 17,102,433 (GRCm39) missense probably damaging 1.00
IGL01650:Prune2 APN 19 17,145,656 (GRCm39) missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17,101,267 (GRCm39) missense possibly damaging 0.50
IGL01812:Prune2 APN 19 16,981,141 (GRCm39) missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17,096,002 (GRCm39) missense probably benign 0.00
IGL02195:Prune2 APN 19 17,096,921 (GRCm39) missense probably benign 0.00
IGL02502:Prune2 APN 19 17,101,245 (GRCm39) missense probably benign 0.00
IGL02569:Prune2 APN 19 17,156,223 (GRCm39) missense probably damaging 0.99
IGL02693:Prune2 APN 19 17,101,855 (GRCm39) missense probably benign 0.03
IGL02737:Prune2 APN 19 17,170,775 (GRCm39) nonsense probably null
IGL02794:Prune2 APN 19 17,096,725 (GRCm39) missense probably benign 0.19
IGL02985:Prune2 APN 19 16,993,723 (GRCm39) critical splice donor site probably null
IGL03349:Prune2 APN 19 17,100,710 (GRCm39) missense probably damaging 1.00
3-1:Prune2 UTSW 19 17,102,646 (GRCm39) missense probably benign 0.00
R0060:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17,099,974 (GRCm39) missense probably benign 0.00
R0277:Prune2 UTSW 19 17,098,753 (GRCm39) missense probably damaging 0.99
R0321:Prune2 UTSW 19 17,099,818 (GRCm39) missense probably benign 0.39
R0321:Prune2 UTSW 19 17,098,291 (GRCm39) missense possibly damaging 0.78
R0374:Prune2 UTSW 19 17,098,274 (GRCm39) missense probably benign 0.00
R0380:Prune2 UTSW 19 17,101,371 (GRCm39) missense probably damaging 1.00
R0396:Prune2 UTSW 19 17,100,444 (GRCm39) missense probably benign 0.35
R0408:Prune2 UTSW 19 17,099,674 (GRCm39) missense probably benign 0.00
R0421:Prune2 UTSW 19 17,100,675 (GRCm39) missense probably benign 0.02
R0480:Prune2 UTSW 19 16,984,156 (GRCm39) splice site probably benign
R0531:Prune2 UTSW 19 16,984,117 (GRCm39) missense probably damaging 1.00
R0546:Prune2 UTSW 19 16,998,030 (GRCm39) splice site probably benign
R0554:Prune2 UTSW 19 17,102,582 (GRCm39) nonsense probably null
R0659:Prune2 UTSW 19 17,100,199 (GRCm39) missense probably damaging 1.00
R0699:Prune2 UTSW 19 17,101,319 (GRCm39) missense probably damaging 1.00
R0781:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1110:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1178:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1181:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1337:Prune2 UTSW 19 17,096,971 (GRCm39) missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17,189,681 (GRCm39) missense probably benign 0.40
R1385:Prune2 UTSW 19 17,102,312 (GRCm39) missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17,098,015 (GRCm39) missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17,102,374 (GRCm39) missense probably benign 0.01
R1756:Prune2 UTSW 19 17,101,068 (GRCm39) missense probably benign 0.01
R1765:Prune2 UTSW 19 17,102,962 (GRCm39) missense probably damaging 1.00
R1782:Prune2 UTSW 19 17,099,537 (GRCm39) missense probably benign 0.00
R1817:Prune2 UTSW 19 17,099,445 (GRCm39) missense probably benign 0.00
R1838:Prune2 UTSW 19 17,177,242 (GRCm39) missense probably damaging 1.00
R1851:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1852:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1866:Prune2 UTSW 19 17,100,856 (GRCm39) missense probably damaging 1.00
R1983:Prune2 UTSW 19 16,998,006 (GRCm39) missense probably damaging 0.97
R2014:Prune2 UTSW 19 17,097,887 (GRCm39) missense probably damaging 1.00
R2066:Prune2 UTSW 19 17,098,042 (GRCm39) missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17,097,109 (GRCm39) missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17,185,602 (GRCm39) missense probably damaging 1.00
R2128:Prune2 UTSW 19 17,099,786 (GRCm39) missense probably benign 0.00
R2165:Prune2 UTSW 19 17,097,546 (GRCm39) missense probably benign 0.19
R2241:Prune2 UTSW 19 17,100,456 (GRCm39) missense probably damaging 0.96
R2278:Prune2 UTSW 19 17,095,919 (GRCm39) missense possibly damaging 0.93
R2504:Prune2 UTSW 19 16,977,400 (GRCm39) missense probably damaging 1.00
R2508:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R3055:Prune2 UTSW 19 17,102,407 (GRCm39) missense probably damaging 0.98
R3086:Prune2 UTSW 19 17,098,777 (GRCm39) missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3105:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3547:Prune2 UTSW 19 17,101,712 (GRCm39) missense probably damaging 0.96
R3702:Prune2 UTSW 19 17,156,235 (GRCm39) missense probably damaging 1.00
R3753:Prune2 UTSW 19 17,102,818 (GRCm39) missense probably benign 0.38
R3933:Prune2 UTSW 19 17,101,318 (GRCm39) missense probably damaging 1.00
R3935:Prune2 UTSW 19 17,177,150 (GRCm39) missense probably damaging 1.00
R4022:Prune2 UTSW 19 16,977,384 (GRCm39) missense probably damaging 1.00
R4042:Prune2 UTSW 19 16,981,190 (GRCm39) critical splice donor site probably null
R4164:Prune2 UTSW 19 16,981,098 (GRCm39) missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17,099,274 (GRCm39) missense probably benign 0.00
R4642:Prune2 UTSW 19 16,998,019 (GRCm39) critical splice donor site probably null
R4661:Prune2 UTSW 19 16,977,387 (GRCm39) missense probably damaging 1.00
R4666:Prune2 UTSW 19 17,097,552 (GRCm39) nonsense probably null
R4823:Prune2 UTSW 19 17,097,868 (GRCm39) missense probably damaging 1.00
R4897:Prune2 UTSW 19 17,099,219 (GRCm39) missense probably benign 0.03
R4922:Prune2 UTSW 19 17,100,116 (GRCm39) missense probably benign 0.00
R4962:Prune2 UTSW 19 17,099,637 (GRCm39) missense probably benign 0.11
R5026:Prune2 UTSW 19 17,176,506 (GRCm39) missense probably damaging 1.00
R5042:Prune2 UTSW 19 17,097,161 (GRCm39) missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17,177,274 (GRCm39) missense probably damaging 1.00
R5133:Prune2 UTSW 19 16,980,995 (GRCm39) missense probably damaging 1.00
R5184:Prune2 UTSW 19 17,193,721 (GRCm39) missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5339:Prune2 UTSW 19 17,098,236 (GRCm39) missense probably damaging 1.00
R5363:Prune2 UTSW 19 17,095,630 (GRCm39) missense probably damaging 1.00
R5382:Prune2 UTSW 19 16,981,023 (GRCm39) missense probably damaging 1.00
R5436:Prune2 UTSW 19 16,998,007 (GRCm39) missense probably damaging 1.00
R5480:Prune2 UTSW 19 17,098,311 (GRCm39) missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17,095,573 (GRCm39) missense probably benign 0.19
R5678:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5814:Prune2 UTSW 19 16,993,725 (GRCm39) splice site probably null
R5894:Prune2 UTSW 19 17,098,755 (GRCm39) missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17,096,080 (GRCm39) missense probably benign 0.35
R6207:Prune2 UTSW 19 17,095,480 (GRCm39) missense probably damaging 1.00
R6218:Prune2 UTSW 19 17,098,926 (GRCm39) missense probably benign 0.00
R6573:Prune2 UTSW 19 17,098,522 (GRCm39) missense possibly damaging 0.61
R6573:Prune2 UTSW 19 17,098,521 (GRCm39) missense probably damaging 1.00
R6734:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R6805:Prune2 UTSW 19 17,097,954 (GRCm39) missense probably benign
R6837:Prune2 UTSW 19 17,156,292 (GRCm39) missense probably damaging 1.00
R6850:Prune2 UTSW 19 17,099,552 (GRCm39) missense probably benign 0.00
R6858:Prune2 UTSW 19 17,095,470 (GRCm39) missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17,100,592 (GRCm39) missense probably damaging 1.00
R6954:Prune2 UTSW 19 16,977,385 (GRCm39) missense probably damaging 1.00
R7098:Prune2 UTSW 19 17,097,966 (GRCm39) missense probably benign 0.39
R7102:Prune2 UTSW 19 17,098,577 (GRCm39) missense probably benign 0.24
R7246:Prune2 UTSW 19 17,098,732 (GRCm39) missense probably damaging 0.99
R7284:Prune2 UTSW 19 17,097,250 (GRCm39) missense probably damaging 1.00
R7295:Prune2 UTSW 19 17,097,261 (GRCm39) missense probably benign 0.01
R7371:Prune2 UTSW 19 17,096,734 (GRCm39) missense probably benign 0.02
R7651:Prune2 UTSW 19 17,097,772 (GRCm39) missense probably damaging 1.00
R7830:Prune2 UTSW 19 17,100,038 (GRCm39) missense probably benign 0.21
R7872:Prune2 UTSW 19 17,096,798 (GRCm39) missense probably benign 0.05
R7881:Prune2 UTSW 19 17,100,393 (GRCm39) missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17,156,223 (GRCm39) missense probably damaging 0.99
R7969:Prune2 UTSW 19 17,179,034 (GRCm39) missense probably damaging 0.98
R8092:Prune2 UTSW 19 17,097,357 (GRCm39) missense probably damaging 1.00
R8110:Prune2 UTSW 19 17,098,083 (GRCm39) missense probably benign 0.22
R8115:Prune2 UTSW 19 17,101,288 (GRCm39) missense probably benign 0.02
R8129:Prune2 UTSW 19 17,096,200 (GRCm39) missense probably benign 0.01
R8169:Prune2 UTSW 19 17,102,455 (GRCm39) missense probably benign 0.10
R8171:Prune2 UTSW 19 17,097,882 (GRCm39) missense probably damaging 1.00
R8176:Prune2 UTSW 19 17,095,656 (GRCm39) missense probably damaging 1.00
R8200:Prune2 UTSW 19 17,102,337 (GRCm39) missense probably benign 0.01
R8217:Prune2 UTSW 19 17,097,480 (GRCm39) missense probably benign 0.01
R8258:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8259:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8289:Prune2 UTSW 19 17,100,373 (GRCm39) missense probably benign 0.43
R8329:Prune2 UTSW 19 17,098,629 (GRCm39) missense probably benign 0.02
R8342:Prune2 UTSW 19 17,103,027 (GRCm39) missense probably benign 0.01
R8558:Prune2 UTSW 19 17,099,602 (GRCm39) missense probably damaging 0.98
R8732:Prune2 UTSW 19 17,097,769 (GRCm39) missense probably damaging 1.00
R8743:Prune2 UTSW 19 17,096,920 (GRCm39) missense probably benign 0.22
R8769:Prune2 UTSW 19 17,100,442 (GRCm39) missense probably damaging 0.96
R8862:Prune2 UTSW 19 17,097,510 (GRCm39) missense probably benign 0.04
R8936:Prune2 UTSW 19 17,099,199 (GRCm39) missense probably benign 0.24
R9040:Prune2 UTSW 19 17,097,991 (GRCm39) missense probably damaging 1.00
R9084:Prune2 UTSW 19 17,097,741 (GRCm39) missense probably damaging 1.00
R9224:Prune2 UTSW 19 17,097,393 (GRCm39) missense probably damaging 1.00
R9273:Prune2 UTSW 19 17,095,690 (GRCm39) missense possibly damaging 0.74
R9275:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9278:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9290:Prune2 UTSW 19 17,145,691 (GRCm39) missense probably benign 0.41
R9305:Prune2 UTSW 19 17,097,625 (GRCm39) missense probably benign 0.14
R9317:Prune2 UTSW 19 17,099,034 (GRCm39) missense probably benign 0.00
R9354:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R9373:Prune2 UTSW 19 17,099,502 (GRCm39) missense probably benign
R9394:Prune2 UTSW 19 16,981,053 (GRCm39) missense probably damaging 1.00
R9405:Prune2 UTSW 19 17,193,708 (GRCm39) missense probably damaging 0.99
R9476:Prune2 UTSW 19 17,096,706 (GRCm39) missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17,099,794 (GRCm39) missense probably benign 0.00
X0019:Prune2 UTSW 19 17,098,881 (GRCm39) missense probably benign 0.16
X0028:Prune2 UTSW 19 17,100,249 (GRCm39) missense probably damaging 1.00
X0064:Prune2 UTSW 19 17,099,739 (GRCm39) missense probably damaging 1.00
X0066:Prune2 UTSW 19 17,096,154 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATTTACTTCACTTGCCTCTGG -3'
(R):5'- AAACAAGTCCAGTCTCAGGC -3'

Sequencing Primer
(F):5'- TGCCTCTGGTGATAAATACCTG -3'
(R):5'- AGTCTCAGGCAGGACTCTATC -3'
Posted On 2014-06-30