Mutagenetix > Incidental Mutation

Incidental Mutation 'R1912:Unc80'

210335

Institutional Source

Beutler Lab

Gene Symbol

Unc80

Ensembl Gene

ENSMUSG00000055567

Gene Name

unc-80, NALCN activator

Synonyms

C030018G13Rik, C230061B10Rik

MMRRC Submission

039930-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.915) question?

Stock #

R1912 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66468367-66699148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66510625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 681 (V681M)

Ref Sequence

ENSEMBL: ENSMUSP00000053692 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000061620
AA Change: V681M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: V681M

Domain	Start	End	E-Value	Type
Pfam:UNC80	16	236	2.2e-94	PFAM
low complexity region	372	385	N/A	INTRINSIC
low complexity region	493	502	N/A	INTRINSIC
low complexity region	693	711	N/A	INTRINSIC
low complexity region	723	738	N/A	INTRINSIC
low complexity region	739	769	N/A	INTRINSIC
low complexity region	1038	1055	N/A	INTRINSIC
low complexity region	1067	1084	N/A	INTRINSIC
low complexity region	1309	1328	N/A	INTRINSIC
low complexity region	1477	1489	N/A	INTRINSIC
low complexity region	1676	1681	N/A	INTRINSIC
low complexity region	1842	1848	N/A	INTRINSIC
low complexity region	1854	1868	N/A	INTRINSIC
low complexity region	2461	2480	N/A	INTRINSIC
low complexity region	2726	2740	N/A	INTRINSIC
low complexity region	3121	3144	N/A	INTRINSIC
low complexity region	3245	3254	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212557
AA Change: V681M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
2810474O19Rik	T	A	6: 149,328,844	D1129E	possibly damaging	Het
2900092C05Rik	A	G	7: 12,554,655	M132V	probably benign	Het
4921524L21Rik	T	A	18: 6,620,205	I45N	possibly damaging	Het
9230113P08Rik	A	T	9: 35,908,619	T23S	probably benign	Het
Abcb6	A	G	1: 75,179,955	V55A	probably benign	Het
Adam28	A	T	14: 68,644,331	D105E	probably benign	Het
Ahnak	T	C	19: 9,017,881	S5510P	probably damaging	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Alx1	A	G	10: 103,025,361	L102P	probably damaging	Het
Ankrd50	C	T	3: 38,456,776	V481I	probably benign	Het
Aox4	G	T	1: 58,264,402	G1200W	probably damaging	Het
Arhgap45	A	C	10: 80,020,690	D24A	probably benign	Het
Arhgef16	A	T	4: 154,280,323		probably null	Het
Asic4	A	T	1: 75,469,232	Y235F	possibly damaging	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Atg4d	A	G	9: 21,272,639	D350G	probably damaging	Het
Auts2	T	C	5: 131,443,574	T347A	probably damaging	Het
Bsnd	A	T	4: 106,488,030	L73*	probably null	Het
Cachd1	A	T	4: 100,953,169	S323C	probably damaging	Het
Cacna1e	A	G	1: 154,436,449	I1290T	probably damaging	Het
Cdh8	T	A	8: 99,098,870	N498Y	probably damaging	Het
Cdkn3	A	G	14: 46,769,834		probably null	Het
Celf2	A	T	2: 6,615,753	M40K	probably damaging	Het
Cfap57	A	C	4: 118,615,010	S57R	probably damaging	Het
Cfh	A	G	1: 140,136,141		probably null	Het
Chdh	A	G	14: 30,032,788	S252G	probably benign	Het
Col8a1	T	A	16: 57,627,924	I408F	unknown	Het
Corin	C	T	5: 72,358,403	C303Y	probably damaging	Het
Crlf2	C	T	5: 109,557,141	C66Y	possibly damaging	Het
Csmd1	C	T	8: 16,233,998		probably null	Het
Cyp4f16	T	C	17: 32,545,044	V270A	probably damaging	Het
Defa29	T	A	8: 21,326,012	H113L	possibly damaging	Het
Dhx35	A	T	2: 158,842,307	N501Y	probably damaging	Het
Dst	A	G	1: 34,291,850	R4690G	probably damaging	Het
Elac2	T	A	11: 64,994,263	D439E	probably benign	Het
Ercc6	A	G	14: 32,576,803	R1383G	probably damaging	Het
Fam69b	A	G	2: 26,632,704	E55G	probably damaging	Het
Fat3	T	A	9: 15,969,988	Y3196F	probably damaging	Het
Fbxw13	A	T	9: 109,181,543	D342E	probably benign	Het
Fmod	A	G	1: 134,040,720	N166S	possibly damaging	Het
Folh1	A	G	7: 86,762,967	S199P	possibly damaging	Het
Fv1	A	G	4: 147,869,778	N267S	possibly damaging	Het
Fyn	T	C	10: 39,526,832	V200A	possibly damaging	Het
Ggnbp2	T	C	11: 84,862,296	N39S	probably benign	Het
Gm10509	A	T	17: 21,690,924	I53F	possibly damaging	Het
Gpr139	A	T	7: 119,144,879	I161N	possibly damaging	Het
Grhl2	C	T	15: 37,358,407	T148I	probably damaging	Het
Hmcn1	C	A	1: 150,604,882	M4514I	probably benign	Het
Igsf10	T	G	3: 59,329,572	T1063P	probably benign	Het
Itgav	A	G	2: 83,795,486	Y792C	possibly damaging	Het
Itgb2l	T	C	16: 96,426,935	Q456R	probably benign	Het
Jph4	G	A	14: 55,108,361	A613V	probably benign	Het
Kcna2	A	G	3: 107,105,401	T433A	probably benign	Het
Kmt2e	A	G	5: 23,492,395	K97R	probably benign	Het
Krba1	C	A	6: 48,415,765	A871E	probably benign	Het
Loxhd1	T	C	18: 77,340,137	F468L	probably benign	Het
Lpin1	A	G	12: 16,546,727	V713A	probably damaging	Het
Ltbp2	T	A	12: 84,785,863	I67F	probably damaging	Het
Mdc1	G	A	17: 35,844,538	R35H	probably benign	Het
Mdc1	A	G	17: 35,850,811	D872G	probably benign	Het
Mgam	C	T	6: 40,764,185	Q959*	probably null	Het
Mttp	T	A	3: 138,116,027	T260S	probably benign	Het
Naalad2	A	T	9: 18,376,535	D266E	probably benign	Het
Nans	T	A	4: 46,500,162	L182H	probably damaging	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nfix	A	T	8: 84,721,677	V407E	probably damaging	Het
Nktr	T	A	9: 121,750,240		probably benign	Het
Nlrp10	G	A	7: 108,925,395	R293*	probably null	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1126	T	C	2: 87,457,383	S73P	probably damaging	Het
Olfr212	A	G	6: 116,515,989	T71A	probably benign	Het
Olfr380	A	T	11: 73,453,994	F73I	probably damaging	Het
Olfr402	T	C	11: 74,155,885	C244R	probably damaging	Het
Olfr452	T	C	6: 42,790,477	I146T	probably benign	Het
Olfr493	A	G	7: 108,346,807	L58P	probably damaging	Het
Olfr749	G	A	14: 50,736,778	P128L	probably damaging	Het
Olfr994	T	A	2: 85,430,260	N190Y	probably damaging	Het
Oxld1	A	G	11: 120,456,906	V155A	probably damaging	Het
Pamr1	T	A	2: 102,642,300	F648Y	probably damaging	Het
Parg	T	C	14: 32,210,540	W446R	probably damaging	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Phf7	T	C	14: 31,240,324	I175V	possibly damaging	Het
Pibf1	G	A	14: 99,187,809		probably null	Het
Plcxd1	A	G	5: 110,103,442	I295V	probably benign	Het
Pole2	A	C	12: 69,209,990	Y254D	probably damaging	Het
Ppm1e	T	A	11: 87,244,370	I225F	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnase2b	T	G	14: 51,162,900	V146G	probably damaging	Het
Rnf169	G	A	7: 99,926,254	T378I	probably damaging	Het
Rpf2	A	G	10: 40,236,201	F80L	probably benign	Het
Sec11c	T	A	18: 65,814,874	D128E	probably damaging	Het
Sept12	A	G	16: 4,988,553	V248A	probably damaging	Het
Serinc1	T	C	10: 57,525,451	N82S	probably benign	Het
Serpina9	A	C	12: 104,001,249	W296G	probably damaging	Het
Sgo2b	A	C	8: 63,931,469	D164E	probably damaging	Het
Slc15a3	A	G	19: 10,848,613	N223D	probably damaging	Het
Slc44a3	A	G	3: 121,532,166	Y12H	probably benign	Het
Slco3a1	A	G	7: 74,504,611	F42S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Sorl1	A	T	9: 42,081,950	D259E	probably damaging	Het
Stpg2	G	A	3: 139,522,981		probably null	Het
Strn	T	A	17: 78,684,395	Y165F	probably damaging	Het
Sval2	T	A	6: 41,864,320	*106R	probably null	Het
Tcaf3	A	G	6: 42,596,688	S197P	possibly damaging	Het
Tespa1	C	A	10: 130,354,723	T73N	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Thoc5	C	A	11: 4,915,561	T380K	probably benign	Het
Tmprss7	T	A	16: 45,656,548	R784*	probably null	Het
Trank1	A	T	9: 111,390,709	L2171F	probably benign	Het
Trpm2	T	G	10: 77,945,876	K303T	probably benign	Het
Tsta3	A	T	15: 75,925,649	D278E	possibly damaging	Het
Usp40	A	G	1: 87,946,646	F1131L	probably benign	Het
Vmn1r215	A	T	13: 23,076,503	I238F	possibly damaging	Het
Vwa3a	A	T	7: 120,795,627	Y890F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,860	L234P	probably damaging	Het
Zfp109	A	G	7: 24,228,251	S578P	probably damaging	Het
Zfp704	T	C	3: 9,609,358	D121G	unknown	Het
Zgrf1	G	T	3: 127,563,137	V671L	probably benign	Het
Zkscan8	A	T	13: 21,520,757	C265*	probably null	Het
Zscan26	T	C	13: 21,445,140	I398V	possibly damaging	Het

Other mutations in Unc80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Unc80	APN	1	66654395	missense	possibly damaging	0.53
IGL00340:Unc80	APN	1	66606459	missense	possibly damaging	0.73
IGL00783:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00784:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00935:Unc80	APN	1	66627266	missense	possibly damaging	0.53
IGL01094:Unc80	APN	1	66695433	missense	possibly damaging	0.90
IGL01466:Unc80	APN	1	66622486	missense	probably benign	0.33
IGL01577:Unc80	APN	1	66529968	splice site	probably null
IGL01626:Unc80	APN	1	66551054	critical splice donor site	probably null
IGL01640:Unc80	APN	1	66679585	missense	probably benign	0.33
IGL01775:Unc80	APN	1	66601056	missense	possibly damaging	0.94
IGL01960:Unc80	APN	1	66608500	splice site	probably benign
IGL01991:Unc80	APN	1	66469509	nonsense	probably null
IGL02022:Unc80	APN	1	66626516	missense	possibly damaging	0.53
IGL02073:Unc80	APN	1	66612227	missense	possibly damaging	0.85
IGL02077:Unc80	APN	1	66525716	missense	possibly damaging	0.77
IGL02197:Unc80	APN	1	66530065	missense	probably benign	0.39
IGL02198:Unc80	APN	1	66529986	missense	possibly damaging	0.88
IGL02228:Unc80	APN	1	66608428	missense	possibly damaging	0.72
IGL02327:Unc80	APN	1	66641673	missense	probably benign	0.33
IGL02447:Unc80	APN	1	66503544	missense	possibly damaging	0.86
IGL02489:Unc80	APN	1	66525701	missense	probably benign	0.07
IGL02546:Unc80	APN	1	66554953	missense	possibly damaging	0.83
IGL02629:Unc80	APN	1	66483317	missense	possibly damaging	0.46
IGL02631:Unc80	APN	1	66530063	missense	probably damaging	0.98
IGL02839:Unc80	APN	1	66671675	missense	possibly damaging	0.53
IGL02960:Unc80	APN	1	66678058	splice site	probably benign
IGL02974:Unc80	APN	1	66525658	missense	possibly damaging	0.95
IGL03060:Unc80	APN	1	66637010	missense	possibly damaging	0.96
IGL03062:Unc80	APN	1	66509489	missense	probably damaging	0.96
IGL03074:Unc80	APN	1	66671718	splice site	probably benign
IGL03086:Unc80	APN	1	66509474	missense	probably damaging	0.99
IGL03105:Unc80	APN	1	66472099	missense	probably damaging	0.96
IGL03107:Unc80	APN	1	66631454	missense	probably damaging	0.98
IGL03158:Unc80	APN	1	66641674	missense	probably benign	0.33
IGL03220:Unc80	APN	1	66504938	missense	probably damaging	0.99
IGL03271:Unc80	APN	1	66695603	unclassified	probably benign
IGL03332:Unc80	APN	1	66503631	missense	probably damaging	1.00
IGL03347:Unc80	APN	1	66695466	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0026:Unc80	UTSW	1	66521584	missense	probably benign	0.27
R0055:Unc80	UTSW	1	66506623	splice site	probably benign
R0149:Unc80	UTSW	1	66521601	missense	possibly damaging	0.82
R0325:Unc80	UTSW	1	66510881	missense	probably damaging	1.00
R0329:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0330:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0355:Unc80	UTSW	1	66549856	missense	possibly damaging	0.77
R0412:Unc80	UTSW	1	66550937	splice site	probably benign
R0422:Unc80	UTSW	1	66483338	missense	probably damaging	1.00
R0477:Unc80	UTSW	1	66570001	missense	probably damaging	0.99
R0507:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0513:Unc80	UTSW	1	66622474	missense	possibly damaging	0.73
R0553:Unc80	UTSW	1	66506669	missense	probably damaging	0.97
R0626:Unc80	UTSW	1	66608442	missense	probably benign	0.01
R0655:Unc80	UTSW	1	66503781	missense	probably damaging	0.98
R0742:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0755:Unc80	UTSW	1	66504923	missense	probably damaging	1.00
R0782:Unc80	UTSW	1	66622581	missense	possibly damaging	0.53
R0837:Unc80	UTSW	1	66648944	missense	possibly damaging	0.73
R0841:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R0893:Unc80	UTSW	1	66521486	missense	probably damaging	0.97
R0900:Unc80	UTSW	1	66671598	missense	probably benign	0.33
R0924:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0930:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0989:Unc80	UTSW	1	66646440	missense	possibly damaging	0.53
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1224:Unc80	UTSW	1	66471980	missense	probably damaging	1.00
R1240:Unc80	UTSW	1	66635902	missense	possibly damaging	0.85
R1245:Unc80	UTSW	1	66555095	missense	possibly damaging	0.94
R1467:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1473:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1500:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1556:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1562:Unc80	UTSW	1	66637957	missense	probably damaging	1.00
R1655:Unc80	UTSW	1	66672756	missense	possibly damaging	0.86
R1674:Unc80	UTSW	1	66509308	missense	probably damaging	1.00
R1680:Unc80	UTSW	1	66503669	nonsense	probably null
R1739:Unc80	UTSW	1	66527892	missense	probably damaging	0.97
R1756:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1783:Unc80	UTSW	1	66683273	missense	probably benign	0.01
R1834:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1854:Unc80	UTSW	1	66631414	missense	possibly damaging	0.93
R1871:Unc80	UTSW	1	66510717	missense	possibly damaging	0.77
R1878:Unc80	UTSW	1	66509402	missense	probably damaging	0.96
R1883:Unc80	UTSW	1	66525770	missense	possibly damaging	0.89
R1990:Unc80	UTSW	1	66692549	missense	probably damaging	0.97
R2007:Unc80	UTSW	1	66503776	missense	probably damaging	1.00
R2035:Unc80	UTSW	1	66606593	missense	probably damaging	0.98
R2056:Unc80	UTSW	1	66640552	missense	possibly damaging	0.72
R2060:Unc80	UTSW	1	66640595	missense	possibly damaging	0.53
R2074:Unc80	UTSW	1	66679744	critical splice donor site	probably null
R2088:Unc80	UTSW	1	66590227	missense	possibly damaging	0.77
R2089:Unc80	UTSW	1	66671715	splice site	probably benign
R2091:Unc80	UTSW	1	66671715	splice site	probably benign
R2139:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2169:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2175:Unc80	UTSW	1	66677355	missense	probably damaging	1.00
R2248:Unc80	UTSW	1	66623206	splice site	probably benign
R2255:Unc80	UTSW	1	66618258	missense	possibly damaging	0.53
R2308:Unc80	UTSW	1	66648997	missense	possibly damaging	0.53
R2484:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2507:Unc80	UTSW	1	66612107	missense	possibly damaging	0.53
R2512:Unc80	UTSW	1	66671608	missense	possibly damaging	0.70
R2878:Unc80	UTSW	1	66671576	critical splice acceptor site	probably benign
R3040:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3104:Unc80	UTSW	1	66623291	missense	probably benign	0.33
R3402:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3403:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3413:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3426:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3427:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3428:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3904:Unc80	UTSW	1	66639296	nonsense	probably null
R3916:Unc80	UTSW	1	66677495	missense	probably benign	0.11
R3950:Unc80	UTSW	1	66622570	missense	possibly damaging	0.53
R4642:Unc80	UTSW	1	66671714	splice site	probably null
R4646:Unc80	UTSW	1	66669235	missense	probably benign	0.03
R4655:Unc80	UTSW	1	66671662	missense	probably benign	0.18
R4662:Unc80	UTSW	1	66646436	missense	probably benign	0.01
R4720:Unc80	UTSW	1	66510792	missense	possibly damaging	0.92
R4736:Unc80	UTSW	1	66649672	critical splice acceptor site	probably null
R4795:Unc80	UTSW	1	66527941	missense	probably damaging	0.97
R4888:Unc80	UTSW	1	66644447	missense	probably damaging	0.98
R4917:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4918:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4983:Unc80	UTSW	1	66674732	splice site	probably null
R5051:Unc80	UTSW	1	66509477	missense	probably damaging	0.96
R5111:Unc80	UTSW	1	66527995	missense	possibly damaging	0.66
R5122:Unc80	UTSW	1	66679590	missense	possibly damaging	0.53
R5260:Unc80	UTSW	1	66646587	missense	possibly damaging	0.53
R5351:Unc80	UTSW	1	66606513	missense	possibly damaging	0.73
R5387:Unc80	UTSW	1	66530021	missense	possibly damaging	0.77
R5437:Unc80	UTSW	1	66654578	missense	possibly damaging	0.96
R5525:Unc80	UTSW	1	66606614	missense	possibly damaging	0.72
R5621:Unc80	UTSW	1	66638043	missense	possibly damaging	0.53
R5690:Unc80	UTSW	1	66640572	missense	probably benign	0.08
R5762:Unc80	UTSW	1	66693796	missense	possibly damaging	0.82
R5956:Unc80	UTSW	1	66527964	missense	probably damaging	0.97
R6005:Unc80	UTSW	1	66627257	missense	possibly damaging	0.53
R6025:Unc80	UTSW	1	66695568	missense	possibly damaging	0.90
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6117:Unc80	UTSW	1	66675067	missense	possibly damaging	0.72
R6156:Unc80	UTSW	1	66612250	missense	probably benign	0.01
R6157:Unc80	UTSW	1	66654029	nonsense	probably null
R6189:Unc80	UTSW	1	66677471	missense	probably benign	0.33
R6291:Unc80	UTSW	1	66521597	missense	possibly damaging	0.82
R6367:Unc80	UTSW	1	66672766	missense	probably benign	0.33
R6598:Unc80	UTSW	1	66468540	critical splice donor site	probably null
R6724:Unc80	UTSW	1	66683191	missense	possibly damaging	0.90
R6763:Unc80	UTSW	1	66521477	missense	probably benign	0.00
R6773:Unc80	UTSW	1	66651543	missense	probably benign	0.33
R6883:Unc80	UTSW	1	66646404	missense	probably benign	0.33
R6951:Unc80	UTSW	1	66648511	missense	possibly damaging	0.53
R6965:Unc80	UTSW	1	66646566	missense	probably benign	0.33
R6993:Unc80	UTSW	1	66549793	missense	possibly damaging	0.60
R7041:Unc80	UTSW	1	66503593	missense	probably benign	0.00
R7050:Unc80	UTSW	1	66550908	splice site	probably null
R7067:Unc80	UTSW	1	66646572	missense	possibly damaging	0.86
R7080:Unc80	UTSW	1	66646521	missense	possibly damaging	0.53
R7193:Unc80	UTSW	1	66549784	missense	possibly damaging	0.60
R7197:Unc80	UTSW	1	66521566	nonsense	probably null
R7278:Unc80	UTSW	1	66552209	missense	possibly damaging	0.82
R7290:Unc80	UTSW	1	66601197	missense	probably damaging	0.97
R7391:Unc80	UTSW	1	66695528	missense	probably benign	0.18
R7401:Unc80	UTSW	1	66646415	missense	possibly damaging	0.96
R7470:Unc80	UTSW	1	66622462	missense	probably benign	0.02
R7573:Unc80	UTSW	1	66521537	missense	probably damaging	1.00
R7637:Unc80	UTSW	1	66672684	missense	possibly damaging	0.86
R7678:Unc80	UTSW	1	66649722	missense	probably benign	0.33
R7697:Unc80	UTSW	1	66637945	missense	possibly damaging	0.93
R7746:Unc80	UTSW	1	66677385	missense	probably benign	0.33
R7768:Unc80	UTSW	1	66510595	missense	possibly damaging	0.56
R7796:Unc80	UTSW	1	66503714	missense	probably benign
R7855:Unc80	UTSW	1	66483349	missense	possibly damaging	0.78
R7878:Unc80	UTSW	1	66601141	missense	possibly damaging	0.88
R7879:Unc80	UTSW	1	66510707	missense	probably benign	0.00
R8024:Unc80	UTSW	1	66606644	missense	possibly damaging	0.86
R8026:Unc80	UTSW	1	66483304	missense	possibly damaging	0.92
R8115:Unc80	UTSW	1	66648913	missense	probably benign	0.00
R8135:Unc80	UTSW	1	66509287	missense	possibly damaging	0.49
R8170:Unc80	UTSW	1	66651533	missense	probably benign	0.33
R8239:Unc80	UTSW	1	66654019	missense	probably benign
R8249:Unc80	UTSW	1	66619491	missense	probably benign	0.01
R8275:Unc80	UTSW	1	66640614	nonsense	probably null
R8288:Unc80	UTSW	1	66473350	missense	probably benign	0.07
R8341:Unc80	UTSW	1	66649033	missense	possibly damaging	0.73
R8356:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8433:Unc80	UTSW	1	66638028	nonsense	probably null
R8456:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8464:Unc80	UTSW	1	66473264	missense	probably damaging	1.00
R8483:Unc80	UTSW	1	66693710	missense	possibly damaging	0.83
R8509:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8686:Unc80	UTSW	1	66612268	missense	possibly damaging	0.53
R8701:Unc80	UTSW	1	66638032	missense	possibly damaging	0.85
R8729:Unc80	UTSW	1	66608490	missense	probably benign	0.01
R8755:Unc80	UTSW	1	66612131	missense	possibly damaging	0.53
R8771:Unc80	UTSW	1	66646395	missense	possibly damaging	0.85
R8866:Unc80	UTSW	1	66590229	missense	probably benign	0.05
R8877:Unc80	UTSW	1	66527985	missense	possibly damaging	0.89
R8942:Unc80	UTSW	1	66473309	missense	possibly damaging	0.94
R8976:Unc80	UTSW	1	66472010	missense	possibly damaging	0.87
R9063:Unc80	UTSW	1	66606657	critical splice donor site	probably null
R9095:Unc80	UTSW	1	66506753	missense	probably damaging	1.00
R9125:Unc80	UTSW	1	66679581	missense	probably benign	0.18
R9130:Unc80	UTSW	1	66638085	missense	possibly damaging	0.85
R9165:Unc80	UTSW	1	66549841	missense	probably null	0.95
R9220:Unc80	UTSW	1	66507375	missense	probably damaging	1.00
R9262:Unc80	UTSW	1	66555252	intron	probably benign
R9334:Unc80	UTSW	1	66649760	missense	possibly damaging	0.73
R9374:Unc80	UTSW	1	66590301	missense	possibly damaging	0.95
R9387:Unc80	UTSW	1	66549938	critical splice donor site	probably null
R9415:Unc80	UTSW	1	66510905	missense
R9427:Unc80	UTSW	1	66554999	missense	probably damaging	1.00
R9436:Unc80	UTSW	1	66693805	critical splice donor site	probably null
R9454:Unc80	UTSW	1	66695590	missense	possibly damaging	0.53
R9522:Unc80	UTSW	1	66638062	missense	possibly damaging	0.73
R9539:Unc80	UTSW	1	66570004	critical splice donor site	probably null
R9552:Unc80	UTSW	1	66678123	missense	possibly damaging	0.85
R9667:Unc80	UTSW	1	66612128	missense	possibly damaging	0.86
R9720:Unc80	UTSW	1	66644326	missense	possibly damaging	0.53
R9749:Unc80	UTSW	1	66505020	missense	probably damaging	0.99
R9789:Unc80	UTSW	1	66612212	missense	possibly damaging	0.53
X0019:Unc80	UTSW	1	66648382	missense	probably benign	0.33
X0021:Unc80	UTSW	1	66509266	critical splice acceptor site	probably null
X0024:Unc80	UTSW	1	66491046	missense	probably benign	0.21
X0062:Unc80	UTSW	1	66623259	missense	probably benign	0.02
X0066:Unc80	UTSW	1	66530757	missense	possibly damaging	0.77
Y4335:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4336:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4338:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Z1088:Unc80	UTSW	1	66646451	missense	possibly damaging	0.85
Z1176:Unc80	UTSW	1	66694409	missense	probably benign
Z1177:Unc80	UTSW	1	66646398	missense	possibly damaging	0.72
Z1177:Unc80	UTSW	1	66695339	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACAATCTCTTTGGTGGCGAG -3'
(R):5'- ATTCTTCTCATAAGGGCCACC -3'

Sequencing Primer
(F):5'- TGGCGAGATTGGAAGGATTAAC -3'
(R):5'- ACCATCTCCAGCTCCACTAG -3'

Posted On

2014-06-30