Incidental Mutation 'R1912:Unc80'
ID 210335
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C030018G13Rik, C230061B10Rik
MMRRC Submission 039930-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock # R1912 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66468367-66699148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66510625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 681 (V681M)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061620
AA Change: V681M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: V681M

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212557
AA Change: V681M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2810474O19Rik T A 6: 149,328,844 D1129E possibly damaging Het
2900092C05Rik A G 7: 12,554,655 M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 I45N possibly damaging Het
9230113P08Rik A T 9: 35,908,619 T23S probably benign Het
Abcb6 A G 1: 75,179,955 V55A probably benign Het
Adam28 A T 14: 68,644,331 D105E probably benign Het
Ahnak T C 19: 9,017,881 S5510P probably damaging Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Alx1 A G 10: 103,025,361 L102P probably damaging Het
Ankrd50 C T 3: 38,456,776 V481I probably benign Het
Aox4 G T 1: 58,264,402 G1200W probably damaging Het
Arhgap45 A C 10: 80,020,690 D24A probably benign Het
Arhgef16 A T 4: 154,280,323 probably null Het
Asic4 A T 1: 75,469,232 Y235F possibly damaging Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Atg4d A G 9: 21,272,639 D350G probably damaging Het
Auts2 T C 5: 131,443,574 T347A probably damaging Het
Bsnd A T 4: 106,488,030 L73* probably null Het
Cachd1 A T 4: 100,953,169 S323C probably damaging Het
Cacna1e A G 1: 154,436,449 I1290T probably damaging Het
Cdh8 T A 8: 99,098,870 N498Y probably damaging Het
Cdkn3 A G 14: 46,769,834 probably null Het
Celf2 A T 2: 6,615,753 M40K probably damaging Het
Cfap57 A C 4: 118,615,010 S57R probably damaging Het
Cfh A G 1: 140,136,141 probably null Het
Chdh A G 14: 30,032,788 S252G probably benign Het
Col8a1 T A 16: 57,627,924 I408F unknown Het
Corin C T 5: 72,358,403 C303Y probably damaging Het
Crlf2 C T 5: 109,557,141 C66Y possibly damaging Het
Csmd1 C T 8: 16,233,998 probably null Het
Cyp4f16 T C 17: 32,545,044 V270A probably damaging Het
Defa29 T A 8: 21,326,012 H113L possibly damaging Het
Dhx35 A T 2: 158,842,307 N501Y probably damaging Het
Dst A G 1: 34,291,850 R4690G probably damaging Het
Elac2 T A 11: 64,994,263 D439E probably benign Het
Ercc6 A G 14: 32,576,803 R1383G probably damaging Het
Fam69b A G 2: 26,632,704 E55G probably damaging Het
Fat3 T A 9: 15,969,988 Y3196F probably damaging Het
Fbxw13 A T 9: 109,181,543 D342E probably benign Het
Fmod A G 1: 134,040,720 N166S possibly damaging Het
Folh1 A G 7: 86,762,967 S199P possibly damaging Het
Fv1 A G 4: 147,869,778 N267S possibly damaging Het
Fyn T C 10: 39,526,832 V200A possibly damaging Het
Ggnbp2 T C 11: 84,862,296 N39S probably benign Het
Gm10509 A T 17: 21,690,924 I53F possibly damaging Het
Gpr139 A T 7: 119,144,879 I161N possibly damaging Het
Grhl2 C T 15: 37,358,407 T148I probably damaging Het
Hmcn1 C A 1: 150,604,882 M4514I probably benign Het
Igsf10 T G 3: 59,329,572 T1063P probably benign Het
Itgav A G 2: 83,795,486 Y792C possibly damaging Het
Itgb2l T C 16: 96,426,935 Q456R probably benign Het
Jph4 G A 14: 55,108,361 A613V probably benign Het
Kcna2 A G 3: 107,105,401 T433A probably benign Het
Kmt2e A G 5: 23,492,395 K97R probably benign Het
Krba1 C A 6: 48,415,765 A871E probably benign Het
Loxhd1 T C 18: 77,340,137 F468L probably benign Het
Lpin1 A G 12: 16,546,727 V713A probably damaging Het
Ltbp2 T A 12: 84,785,863 I67F probably damaging Het
Mdc1 G A 17: 35,844,538 R35H probably benign Het
Mdc1 A G 17: 35,850,811 D872G probably benign Het
Mgam C T 6: 40,764,185 Q959* probably null Het
Mttp T A 3: 138,116,027 T260S probably benign Het
Naalad2 A T 9: 18,376,535 D266E probably benign Het
Nans T A 4: 46,500,162 L182H probably damaging Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nfix A T 8: 84,721,677 V407E probably damaging Het
Nktr T A 9: 121,750,240 probably benign Het
Nlrp10 G A 7: 108,925,395 R293* probably null Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1126 T C 2: 87,457,383 S73P probably damaging Het
Olfr212 A G 6: 116,515,989 T71A probably benign Het
Olfr380 A T 11: 73,453,994 F73I probably damaging Het
Olfr402 T C 11: 74,155,885 C244R probably damaging Het
Olfr452 T C 6: 42,790,477 I146T probably benign Het
Olfr493 A G 7: 108,346,807 L58P probably damaging Het
Olfr749 G A 14: 50,736,778 P128L probably damaging Het
Olfr994 T A 2: 85,430,260 N190Y probably damaging Het
Oxld1 A G 11: 120,456,906 V155A probably damaging Het
Pamr1 T A 2: 102,642,300 F648Y probably damaging Het
Parg T C 14: 32,210,540 W446R probably damaging Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Phf7 T C 14: 31,240,324 I175V possibly damaging Het
Pibf1 G A 14: 99,187,809 probably null Het
Plcxd1 A G 5: 110,103,442 I295V probably benign Het
Pole2 A C 12: 69,209,990 Y254D probably damaging Het
Ppm1e T A 11: 87,244,370 I225F probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rnase2b T G 14: 51,162,900 V146G probably damaging Het
Rnf169 G A 7: 99,926,254 T378I probably damaging Het
Rpf2 A G 10: 40,236,201 F80L probably benign Het
Sec11c T A 18: 65,814,874 D128E probably damaging Het
Sept12 A G 16: 4,988,553 V248A probably damaging Het
Serinc1 T C 10: 57,525,451 N82S probably benign Het
Serpina9 A C 12: 104,001,249 W296G probably damaging Het
Sgo2b A C 8: 63,931,469 D164E probably damaging Het
Slc15a3 A G 19: 10,848,613 N223D probably damaging Het
Slc44a3 A G 3: 121,532,166 Y12H probably benign Het
Slco3a1 A G 7: 74,504,611 F42S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx7 A T 3: 117,829,668 probably null Het
Sorl1 A T 9: 42,081,950 D259E probably damaging Het
Stpg2 G A 3: 139,522,981 probably null Het
Strn T A 17: 78,684,395 Y165F probably damaging Het
Sval2 T A 6: 41,864,320 *106R probably null Het
Tcaf3 A G 6: 42,596,688 S197P possibly damaging Het
Tespa1 C A 10: 130,354,723 T73N probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Thoc5 C A 11: 4,915,561 T380K probably benign Het
Tmprss7 T A 16: 45,656,548 R784* probably null Het
Trank1 A T 9: 111,390,709 L2171F probably benign Het
Trpm2 T G 10: 77,945,876 K303T probably benign Het
Tsta3 A T 15: 75,925,649 D278E possibly damaging Het
Usp40 A G 1: 87,946,646 F1131L probably benign Het
Vmn1r215 A T 13: 23,076,503 I238F possibly damaging Het
Vwa3a A T 7: 120,795,627 Y890F probably damaging Het
Zdhhc18 A G 4: 133,613,860 L234P probably damaging Het
Zfp109 A G 7: 24,228,251 S578P probably damaging Het
Zfp704 T C 3: 9,609,358 D121G unknown Het
Zgrf1 G T 3: 127,563,137 V671L probably benign Het
Zkscan8 A T 13: 21,520,757 C265* probably null Het
Zscan26 T C 13: 21,445,140 I398V possibly damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 splice site probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 splice site probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
R7573:Unc80 UTSW 1 66521537 missense probably damaging 1.00
R7637:Unc80 UTSW 1 66672684 missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66649722 missense probably benign 0.33
R7697:Unc80 UTSW 1 66637945 missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66677385 missense probably benign 0.33
R7768:Unc80 UTSW 1 66510595 missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66503714 missense probably benign
R7855:Unc80 UTSW 1 66483349 missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66601141 missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66510707 missense probably benign 0.00
R8024:Unc80 UTSW 1 66606644 missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66483304 missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66648913 missense probably benign 0.00
R8135:Unc80 UTSW 1 66509287 missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66651533 missense probably benign 0.33
R8239:Unc80 UTSW 1 66654019 missense probably benign
R8249:Unc80 UTSW 1 66619491 missense probably benign 0.01
R8275:Unc80 UTSW 1 66640614 nonsense probably null
R8288:Unc80 UTSW 1 66473350 missense probably benign 0.07
R8341:Unc80 UTSW 1 66649033 missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66638028 nonsense probably null
R8456:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66473264 missense probably damaging 1.00
R8483:Unc80 UTSW 1 66693710 missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66612268 missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66638032 missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66608490 missense probably benign 0.01
R8755:Unc80 UTSW 1 66612131 missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66646395 missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66590229 missense probably benign 0.05
R8877:Unc80 UTSW 1 66527985 missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66473309 missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66472010 missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66606657 critical splice donor site probably null
R9095:Unc80 UTSW 1 66506753 missense probably damaging 1.00
R9125:Unc80 UTSW 1 66679581 missense probably benign 0.18
R9130:Unc80 UTSW 1 66638085 missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66549841 missense probably null 0.95
R9220:Unc80 UTSW 1 66507375 missense probably damaging 1.00
R9334:Unc80 UTSW 1 66649760 missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66590301 missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66549938 critical splice donor site probably null
R9415:Unc80 UTSW 1 66510905 missense
R9427:Unc80 UTSW 1 66554999 missense probably damaging 1.00
R9436:Unc80 UTSW 1 66693805 critical splice donor site probably null
R9454:Unc80 UTSW 1 66695590 missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66694409 missense probably benign
Z1177:Unc80 UTSW 1 66646398 missense possibly damaging 0.72
Z1177:Unc80 UTSW 1 66695339 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAATCTCTTTGGTGGCGAG -3'
(R):5'- ATTCTTCTCATAAGGGCCACC -3'

Sequencing Primer
(F):5'- TGGCGAGATTGGAAGGATTAAC -3'
(R):5'- ACCATCTCCAGCTCCACTAG -3'
Posted On 2014-06-30