Incidental Mutation 'R1912:Abcb6'
ID 210336
Institutional Source Beutler Lab
Gene Symbol Abcb6
Ensembl Gene ENSMUSG00000026198
Gene Name ATP-binding cassette, sub-family B member 6
Synonyms 1200005B17Rik
MMRRC Submission 039930-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.308) question?
Stock # R1912 (G1)
Quality Score 147
Status Not validated
Chromosome 1
Chromosomal Location 75148361-75157036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75156599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000027396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027396] [ENSMUST00000040689] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q9DC29
Predicted Effect probably benign
Transcript: ENSMUST00000027396
AA Change: V55A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: V55A

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040689
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000188347
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189702
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably benign
Transcript: ENSMUST00000189820
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,288,582 (GRCm39) M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 (GRCm39) I45N possibly damaging Het
Adam28 A T 14: 68,881,780 (GRCm39) D105E probably benign Het
Ahnak T C 19: 8,995,245 (GRCm39) S5510P probably damaging Het
Aldh3b1 T G 19: 3,971,187 (GRCm39) D159A probably damaging Het
Alx1 A G 10: 102,861,222 (GRCm39) L102P probably damaging Het
Ankrd50 C T 3: 38,510,925 (GRCm39) V481I probably benign Het
Aox4 G T 1: 58,303,561 (GRCm39) G1200W probably damaging Het
Arhgap45 A C 10: 79,856,524 (GRCm39) D24A probably benign Het
Arhgef16 A T 4: 154,364,780 (GRCm39) probably null Het
Asic4 A T 1: 75,445,876 (GRCm39) Y235F possibly damaging Het
Asph T C 4: 9,453,335 (GRCm39) E646G probably damaging Het
Atg4d A G 9: 21,183,935 (GRCm39) D350G probably damaging Het
Auts2 T C 5: 131,472,412 (GRCm39) T347A probably damaging Het
Bsnd A T 4: 106,345,227 (GRCm39) L73* probably null Het
Cachd1 A T 4: 100,810,366 (GRCm39) S323C probably damaging Het
Cacna1e A G 1: 154,312,195 (GRCm39) I1290T probably damaging Het
Cdh8 T A 8: 99,825,502 (GRCm39) N498Y probably damaging Het
Cdkn3 A G 14: 47,007,291 (GRCm39) probably null Het
Celf2 A T 2: 6,620,564 (GRCm39) M40K probably damaging Het
Cfap57 A C 4: 118,472,207 (GRCm39) S57R probably damaging Het
Cfh A G 1: 140,063,879 (GRCm39) probably null Het
Chdh A G 14: 29,754,745 (GRCm39) S252G probably benign Het
Col8a1 T A 16: 57,448,287 (GRCm39) I408F unknown Het
Corin C T 5: 72,515,746 (GRCm39) C303Y probably damaging Het
Crlf2 C T 5: 109,705,007 (GRCm39) C66Y possibly damaging Het
Csmd1 C T 8: 16,284,012 (GRCm39) probably null Het
Cyp4f16 T C 17: 32,764,018 (GRCm39) V270A probably damaging Het
Defa29 T A 8: 21,816,028 (GRCm39) H113L possibly damaging Het
Dhx35 A T 2: 158,684,227 (GRCm39) N501Y probably damaging Het
Dipk1b A G 2: 26,522,716 (GRCm39) E55G probably damaging Het
Dst A G 1: 34,330,931 (GRCm39) R4690G probably damaging Het
Elac2 T A 11: 64,885,089 (GRCm39) D439E probably benign Het
Ercc6 A G 14: 32,298,760 (GRCm39) R1383G probably damaging Het
Fat3 T A 9: 15,881,284 (GRCm39) Y3196F probably damaging Het
Fbxw13 A T 9: 109,010,611 (GRCm39) D342E probably benign Het
Fmod A G 1: 133,968,458 (GRCm39) N166S possibly damaging Het
Folh1 A G 7: 86,412,175 (GRCm39) S199P possibly damaging Het
Fv1 A G 4: 147,954,235 (GRCm39) N267S possibly damaging Het
Fyn T C 10: 39,402,828 (GRCm39) V200A possibly damaging Het
Gfus A T 15: 75,797,498 (GRCm39) D278E possibly damaging Het
Ggnbp2 T C 11: 84,753,122 (GRCm39) N39S probably benign Het
Gm10509 A T 17: 21,909,831 (GRCm39) I53F possibly damaging Het
Gpr139 A T 7: 118,744,102 (GRCm39) I161N possibly damaging Het
Grhl2 C T 15: 37,358,651 (GRCm39) T148I probably damaging Het
Hmcn1 C A 1: 150,480,633 (GRCm39) M4514I probably benign Het
Igsf10 T G 3: 59,236,993 (GRCm39) T1063P probably benign Het
Itgav A G 2: 83,625,830 (GRCm39) Y792C possibly damaging Het
Itgb2l T C 16: 96,228,135 (GRCm39) Q456R probably benign Het
Jph4 G A 14: 55,345,818 (GRCm39) A613V probably benign Het
Kcna2 A G 3: 107,012,717 (GRCm39) T433A probably benign Het
Kmt2e A G 5: 23,697,393 (GRCm39) K97R probably benign Het
Krba1 C A 6: 48,392,699 (GRCm39) A871E probably benign Het
Loxhd1 T C 18: 77,427,833 (GRCm39) F468L probably benign Het
Lpin1 A G 12: 16,596,728 (GRCm39) V713A probably damaging Het
Ltbp2 T A 12: 84,832,637 (GRCm39) I67F probably damaging Het
Mdc1 G A 17: 36,155,430 (GRCm39) R35H probably benign Het
Mdc1 A G 17: 36,161,703 (GRCm39) D872G probably benign Het
Mgam C T 6: 40,741,119 (GRCm39) Q959* probably null Het
Mttp T A 3: 137,821,788 (GRCm39) T260S probably benign Het
Naalad2 A T 9: 18,287,831 (GRCm39) D266E probably benign Het
Nans T A 4: 46,500,162 (GRCm39) L182H probably damaging Het
Nbas T A 12: 13,616,145 (GRCm39) C2228S probably benign Het
Nfix A T 8: 85,448,306 (GRCm39) V407E probably damaging Het
Nktr T A 9: 121,579,306 (GRCm39) probably benign Het
Nlrp10 G A 7: 108,524,602 (GRCm39) R293* probably null Het
Nrxn3 T C 12: 88,762,112 (GRCm39) F53S probably damaging Het
Or11h4 G A 14: 50,974,235 (GRCm39) P128L probably damaging Het
Or12e7 T C 2: 87,287,727 (GRCm39) S73P probably damaging Het
Or1e21 A T 11: 73,344,820 (GRCm39) F73I probably damaging Het
Or2f2 T C 6: 42,767,411 (GRCm39) I146T probably benign Het
Or3a1c T C 11: 74,046,711 (GRCm39) C244R probably damaging Het
Or5ak24 T A 2: 85,260,604 (GRCm39) N190Y probably damaging Het
Or5p68 A G 7: 107,946,014 (GRCm39) L58P probably damaging Het
Or6d12 A G 6: 116,492,950 (GRCm39) T71A probably benign Het
Oxld1 A G 11: 120,347,732 (GRCm39) V155A probably damaging Het
Pamr1 T A 2: 102,472,645 (GRCm39) F648Y probably damaging Het
Parg T C 14: 31,932,497 (GRCm39) W446R probably damaging Het
Pate13 A T 9: 35,819,915 (GRCm39) T23S probably benign Het
Phf3 A T 1: 30,843,426 (GRCm39) H1844Q probably damaging Het
Phf7 T C 14: 30,962,281 (GRCm39) I175V possibly damaging Het
Pibf1 G A 14: 99,425,245 (GRCm39) probably null Het
Plcxd1 A G 5: 110,251,308 (GRCm39) I295V probably benign Het
Pole2 A C 12: 69,256,764 (GRCm39) Y254D probably damaging Het
Ppm1e T A 11: 87,135,196 (GRCm39) I225F probably benign Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Resf1 T A 6: 149,230,342 (GRCm39) D1129E possibly damaging Het
Rnase2b T G 14: 51,400,357 (GRCm39) V146G probably damaging Het
Rnf169 G A 7: 99,575,461 (GRCm39) T378I probably damaging Het
Rpf2 A G 10: 40,112,197 (GRCm39) F80L probably benign Het
Sec11c T A 18: 65,947,945 (GRCm39) D128E probably damaging Het
Septin12 A G 16: 4,806,417 (GRCm39) V248A probably damaging Het
Serinc1 T C 10: 57,401,547 (GRCm39) N82S probably benign Het
Serpina9 A C 12: 103,967,508 (GRCm39) W296G probably damaging Het
Sgo2b A C 8: 64,384,503 (GRCm39) D164E probably damaging Het
Slc15a3 A G 19: 10,825,977 (GRCm39) N223D probably damaging Het
Slc44a3 A G 3: 121,325,815 (GRCm39) Y12H probably benign Het
Slco3a1 A G 7: 74,154,359 (GRCm39) F42S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx7 A T 3: 117,623,317 (GRCm39) probably null Het
Sorl1 A T 9: 41,993,246 (GRCm39) D259E probably damaging Het
Stpg2 G A 3: 139,228,742 (GRCm39) probably null Het
Strn T A 17: 78,991,824 (GRCm39) Y165F probably damaging Het
Sval2 T A 6: 41,841,254 (GRCm39) *106R probably null Het
Tcaf3 A G 6: 42,573,622 (GRCm39) S197P possibly damaging Het
Tespa1 C A 10: 130,190,592 (GRCm39) T73N probably benign Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Thoc5 C A 11: 4,865,561 (GRCm39) T380K probably benign Het
Tmprss7 T A 16: 45,476,911 (GRCm39) R784* probably null Het
Trank1 A T 9: 111,219,777 (GRCm39) L2171F probably benign Het
Trpm2 T G 10: 77,781,710 (GRCm39) K303T probably benign Het
Unc80 G A 1: 66,549,784 (GRCm39) V681M probably damaging Het
Usp40 A G 1: 87,874,368 (GRCm39) F1131L probably benign Het
Vmn1r215 A T 13: 23,260,673 (GRCm39) I238F possibly damaging Het
Vwa3a A T 7: 120,394,850 (GRCm39) Y890F probably damaging Het
Zdhhc18 A G 4: 133,341,171 (GRCm39) L234P probably damaging Het
Zfp109 A G 7: 23,927,676 (GRCm39) S578P probably damaging Het
Zfp704 T C 3: 9,674,418 (GRCm39) D121G unknown Het
Zgrf1 G T 3: 127,356,786 (GRCm39) V671L probably benign Het
Zkscan8 A T 13: 21,704,927 (GRCm39) C265* probably null Het
Zscan26 T C 13: 21,629,310 (GRCm39) I398V possibly damaging Het
Other mutations in Abcb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Abcb6 APN 1 75,154,646 (GRCm39) missense probably damaging 0.96
1mM(1):Abcb6 UTSW 1 75,148,755 (GRCm39) unclassified probably benign
R0035:Abcb6 UTSW 1 75,151,651 (GRCm39) missense possibly damaging 0.74
R0699:Abcb6 UTSW 1 75,148,553 (GRCm39) missense probably damaging 0.98
R1470:Abcb6 UTSW 1 75,149,323 (GRCm39) unclassified probably benign
R1595:Abcb6 UTSW 1 75,153,944 (GRCm39) splice site probably null
R2078:Abcb6 UTSW 1 75,148,780 (GRCm39) missense probably damaging 1.00
R3105:Abcb6 UTSW 1 75,151,687 (GRCm39) unclassified probably benign
R4015:Abcb6 UTSW 1 75,151,135 (GRCm39) splice site probably null
R4604:Abcb6 UTSW 1 75,156,521 (GRCm39) missense probably benign
R4633:Abcb6 UTSW 1 75,154,426 (GRCm39) unclassified probably benign
R4748:Abcb6 UTSW 1 75,154,002 (GRCm39) missense probably damaging 1.00
R5530:Abcb6 UTSW 1 75,154,556 (GRCm39) unclassified probably benign
R5654:Abcb6 UTSW 1 75,151,479 (GRCm39) splice site probably null
R5841:Abcb6 UTSW 1 75,150,994 (GRCm39) missense possibly damaging 0.88
R6275:Abcb6 UTSW 1 75,149,195 (GRCm39) splice site probably null
R6527:Abcb6 UTSW 1 75,154,132 (GRCm39) critical splice acceptor site probably null
R7188:Abcb6 UTSW 1 75,150,781 (GRCm39) critical splice donor site probably null
R7278:Abcb6 UTSW 1 75,151,017 (GRCm39) missense possibly damaging 0.88
R7451:Abcb6 UTSW 1 75,148,797 (GRCm39) missense probably damaging 1.00
R7481:Abcb6 UTSW 1 75,150,248 (GRCm39) missense probably damaging 1.00
R7608:Abcb6 UTSW 1 75,154,347 (GRCm39) missense probably benign 0.01
R7640:Abcb6 UTSW 1 75,151,489 (GRCm39) splice site probably null
R7883:Abcb6 UTSW 1 75,154,660 (GRCm39) missense possibly damaging 0.81
R7982:Abcb6 UTSW 1 75,150,284 (GRCm39) missense probably damaging 1.00
R8057:Abcb6 UTSW 1 75,151,002 (GRCm39) missense probably damaging 0.99
R8058:Abcb6 UTSW 1 75,156,653 (GRCm39) missense possibly damaging 0.79
R8155:Abcb6 UTSW 1 75,151,413 (GRCm39) missense probably damaging 0.99
R8309:Abcb6 UTSW 1 75,149,588 (GRCm39) missense probably benign 0.43
R9087:Abcb6 UTSW 1 75,150,211 (GRCm39) missense probably damaging 1.00
R9599:Abcb6 UTSW 1 75,151,372 (GRCm39) missense possibly damaging 0.63
R9723:Abcb6 UTSW 1 75,156,366 (GRCm39) missense probably benign
X0009:Abcb6 UTSW 1 75,151,197 (GRCm39) missense probably benign 0.35
Z1177:Abcb6 UTSW 1 75,152,769 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATCCAGACGCCCATTGC -3'
(R):5'- ACATCGCCATGGTGACTGTG -3'

Sequencing Primer
(F):5'- ATTGCCAGACTCTGCCGTG -3'
(R):5'- CATGGTGACTGTGGGCAAC -3'
Posted On 2014-06-30