Incidental Mutation 'R1912:Cfh'
ID210342
Institutional Source Beutler Lab
Gene Symbol Cfh
Ensembl Gene ENSMUSG00000026365
Gene Namecomplement component factor h
SynonymsMud-1, Sas1, Sas-1
MMRRC Submission 039930-MU
Accession Numbers

Genbank: NM_009888; MGI: 88385

Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1912 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location140084708-140183764 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 140136141 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000066859] [ENSMUST00000111976] [ENSMUST00000111977] [ENSMUST00000123238] [ENSMUST00000192880] [ENSMUST00000192880]
Predicted Effect probably null
Transcript: ENSMUST00000066859
SMART Domains Protein: ENSMUSP00000066677
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
CCP 1114 1168 8.04e-15 SMART
CCP 1172 1233 5.57e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111976
SMART Domains Protein: ENSMUSP00000107607
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
CCP 39 98 7.75e-8 SMART
CCP 103 159 2.17e-11 SMART
CCP 164 223 7.5e-15 SMART
CCP 228 280 6.29e-8 SMART
CCP 285 338 2.04e-7 SMART
CCP 343 403 6.35e-4 SMART
CCP 407 460 1.15e-10 SMART
CCP 466 523 3.62e-8 SMART
CCP 527 582 6.45e-5 SMART
CCP 587 640 5.56e-9 SMART
CCP 647 701 3.45e-14 SMART
CCP 708 761 1.82e-13 SMART
CCP 770 820 6.59e-1 SMART
CCP 826 879 1.04e-8 SMART
CCP 885 949 4.66e-11 SMART
CCP 954 1007 3.9e-13 SMART
CCP 1012 1066 1.4e-14 SMART
CCP 1071 1125 2.09e-13 SMART
CCP 1132 1186 8.04e-15 SMART
CCP 1190 1251 5.57e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111977
SMART Domains Protein: ENSMUSP00000107608
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 572 626 3.45e-14 SMART
CCP 633 686 1.82e-13 SMART
CCP 695 745 6.59e-1 SMART
CCP 751 804 1.04e-8 SMART
CCP 810 874 4.66e-11 SMART
CCP 879 932 3.9e-13 SMART
CCP 937 991 1.4e-14 SMART
CCP 996 1050 2.09e-13 SMART
CCP 1057 1111 8.04e-15 SMART
CCP 1115 1176 5.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123238
SMART Domains Protein: ENSMUSP00000115166
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192880
SMART Domains Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CCP 39 98 3.9e-10 SMART
CCP 103 159 1e-13 SMART
CCP 164 223 3.7e-17 SMART
CCP 228 280 3.1e-10 SMART
CCP 285 338 9.9e-10 SMART
CCP 343 403 3.2e-6 SMART
CCP 407 460 5.6e-13 SMART
CCP 467 521 6.7e-17 SMART
CCP 526 580 1e-15 SMART
CCP 587 641 3.8e-17 SMART
CCP 645 706 2.7e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192880
SMART Domains Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CCP 39 98 3.9e-10 SMART
CCP 103 159 1e-13 SMART
CCP 164 223 3.7e-17 SMART
CCP 228 280 3.1e-10 SMART
CCP 285 338 9.9e-10 SMART
CCP 343 403 3.2e-6 SMART
CCP 407 460 5.6e-13 SMART
CCP 467 521 6.7e-17 SMART
CCP 526 580 1e-15 SMART
CCP 587 641 3.8e-17 SMART
CCP 645 706 2.7e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192919
Predicted Effect probably null
Transcript: ENSMUST00000192919
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in markedly reduced serum C3, abnormal renal histology, spontaneous membranoproliferative glomerulonephritis (MPGN), hematuria, proteinuria, and increased mortality at 8 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2810474O19Rik T A 6: 149,328,844 D1129E possibly damaging Het
2900092C05Rik A G 7: 12,554,655 M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 I45N possibly damaging Het
9230113P08Rik A T 9: 35,908,619 T23S probably benign Het
Abcb6 A G 1: 75,179,955 V55A probably benign Het
Adam28 A T 14: 68,644,331 D105E probably benign Het
Ahnak T C 19: 9,017,881 S5510P probably damaging Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Alx1 A G 10: 103,025,361 L102P probably damaging Het
Ankrd50 C T 3: 38,456,776 V481I probably benign Het
Aox4 G T 1: 58,264,402 G1200W probably damaging Het
Arhgap45 A C 10: 80,020,690 D24A probably benign Het
Arhgef16 A T 4: 154,280,323 probably null Het
Asic4 A T 1: 75,469,232 Y235F possibly damaging Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Atg4d A G 9: 21,272,639 D350G probably damaging Het
Auts2 T C 5: 131,443,574 T347A probably damaging Het
Bsnd A T 4: 106,488,030 L73* probably null Het
Cachd1 A T 4: 100,953,169 S323C probably damaging Het
Cacna1e A G 1: 154,436,449 I1290T probably damaging Het
Cdh8 T A 8: 99,098,870 N498Y probably damaging Het
Cdkn3 A G 14: 46,769,834 probably null Het
Celf2 A T 2: 6,615,753 M40K probably damaging Het
Cfap57 A C 4: 118,615,010 S57R probably damaging Het
Chdh A G 14: 30,032,788 S252G probably benign Het
Col8a1 T A 16: 57,627,924 I408F unknown Het
Corin C T 5: 72,358,403 C303Y probably damaging Het
Crlf2 C T 5: 109,557,141 C66Y possibly damaging Het
Csmd1 C T 8: 16,233,998 probably null Het
Cyp4f16 T C 17: 32,545,044 V270A probably damaging Het
Defa29 T A 8: 21,326,012 H113L possibly damaging Het
Dhx35 A T 2: 158,842,307 N501Y probably damaging Het
Dst A G 1: 34,291,850 R4690G probably damaging Het
Elac2 T A 11: 64,994,263 D439E probably benign Het
Ercc6 A G 14: 32,576,803 R1383G probably damaging Het
Fam69b A G 2: 26,632,704 E55G probably damaging Het
Fat3 T A 9: 15,969,988 Y3196F probably damaging Het
Fbxw13 A T 9: 109,181,543 D342E probably benign Het
Fmod A G 1: 134,040,720 N166S possibly damaging Het
Folh1 A G 7: 86,762,967 S199P possibly damaging Het
Fv1 A G 4: 147,869,778 N267S possibly damaging Het
Fyn T C 10: 39,526,832 V200A possibly damaging Het
Ggnbp2 T C 11: 84,862,296 N39S probably benign Het
Gm10509 A T 17: 21,690,924 I53F possibly damaging Het
Gpr139 A T 7: 119,144,879 I161N possibly damaging Het
Grhl2 C T 15: 37,358,407 T148I probably damaging Het
Hmcn1 C A 1: 150,604,882 M4514I probably benign Het
Igsf10 T G 3: 59,329,572 T1063P probably benign Het
Itgav A G 2: 83,795,486 Y792C possibly damaging Het
Itgb2l T C 16: 96,426,935 Q456R probably benign Het
Jph4 G A 14: 55,108,361 A613V probably benign Het
Kcna2 A G 3: 107,105,401 T433A probably benign Het
Kmt2e A G 5: 23,492,395 K97R probably benign Het
Krba1 C A 6: 48,415,765 A871E probably benign Het
Loxhd1 T C 18: 77,340,137 F468L probably benign Het
Lpin1 A G 12: 16,546,727 V713A probably damaging Het
Ltbp2 T A 12: 84,785,863 I67F probably damaging Het
Mdc1 G A 17: 35,844,538 R35H probably benign Het
Mdc1 A G 17: 35,850,811 D872G probably benign Het
Mgam C T 6: 40,764,185 Q959* probably null Het
Mttp T A 3: 138,116,027 T260S probably benign Het
Naalad2 A T 9: 18,376,535 D266E probably benign Het
Nans T A 4: 46,500,162 L182H probably damaging Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nfix A T 8: 84,721,677 V407E probably damaging Het
Nktr T A 9: 121,750,240 probably benign Het
Nlrp10 G A 7: 108,925,395 R293* probably null Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1126 T C 2: 87,457,383 S73P probably damaging Het
Olfr212 A G 6: 116,515,989 T71A probably benign Het
Olfr380 A T 11: 73,453,994 F73I probably damaging Het
Olfr402 T C 11: 74,155,885 C244R probably damaging Het
Olfr452 T C 6: 42,790,477 I146T probably benign Het
Olfr493 A G 7: 108,346,807 L58P probably damaging Het
Olfr749 G A 14: 50,736,778 P128L probably damaging Het
Olfr994 T A 2: 85,430,260 N190Y probably damaging Het
Oxld1 A G 11: 120,456,906 V155A probably damaging Het
Pamr1 T A 2: 102,642,300 F648Y probably damaging Het
Parg T C 14: 32,210,540 W446R probably damaging Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Phf7 T C 14: 31,240,324 I175V possibly damaging Het
Pibf1 G A 14: 99,187,809 probably null Het
Plcxd1 A G 5: 110,103,442 I295V probably benign Het
Pole2 A C 12: 69,209,990 Y254D probably damaging Het
Ppm1e T A 11: 87,244,370 I225F probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rnase2b T G 14: 51,162,900 V146G probably damaging Het
Rnf169 G A 7: 99,926,254 T378I probably damaging Het
Rpf2 A G 10: 40,236,201 F80L probably benign Het
Sec11c T A 18: 65,814,874 D128E probably damaging Het
Sept12 A G 16: 4,988,553 V248A probably damaging Het
Serinc1 T C 10: 57,525,451 N82S probably benign Het
Serpina9 A C 12: 104,001,249 W296G probably damaging Het
Sgo2b A C 8: 63,931,469 D164E probably damaging Het
Slc15a3 A G 19: 10,848,613 N223D probably damaging Het
Slc44a3 A G 3: 121,532,166 Y12H probably benign Het
Slco3a1 A G 7: 74,504,611 F42S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx7 A T 3: 117,829,668 probably null Het
Sorl1 A T 9: 42,081,950 D259E probably damaging Het
Stpg2 G A 3: 139,522,981 probably null Het
Strn T A 17: 78,684,395 Y165F probably damaging Het
Sval2 T A 6: 41,864,320 *106R probably null Het
Tcaf3 A G 6: 42,596,688 S197P possibly damaging Het
Tespa1 C A 10: 130,354,723 T73N probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Thoc5 C A 11: 4,915,561 T380K probably benign Het
Tmprss7 T A 16: 45,656,548 R784* probably null Het
Trank1 A T 9: 111,390,709 L2171F probably benign Het
Trpm2 T G 10: 77,945,876 K303T probably benign Het
Tsta3 A T 15: 75,925,649 D278E possibly damaging Het
Unc80 G A 1: 66,510,625 V681M probably damaging Het
Usp40 A G 1: 87,946,646 F1131L probably benign Het
Vmn1r215 A T 13: 23,076,503 I238F possibly damaging Het
Vwa3a A T 7: 120,795,627 Y890F probably damaging Het
Zdhhc18 A G 4: 133,613,860 L234P probably damaging Het
Zfp109 A G 7: 24,228,251 S578P probably damaging Het
Zfp704 T C 3: 9,609,358 D121G unknown Het
Zgrf1 G T 3: 127,563,137 V671L probably benign Het
Zkscan8 A T 13: 21,520,757 C265* probably null Het
Zscan26 T C 13: 21,445,140 I398V possibly damaging Het
Other mutations in Cfh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cfh APN 1 140088682 missense probably damaging 1.00
IGL01124:Cfh APN 1 140183261 missense probably benign 0.01
IGL01389:Cfh APN 1 140154639 missense probably benign 0.44
IGL01455:Cfh APN 1 140105539 missense possibly damaging 0.51
IGL01877:Cfh APN 1 140100829 missense probably damaging 1.00
IGL02836:Cfh APN 1 140102399 missense probably damaging 1.00
IGL02937:Cfh APN 1 140105442 missense probably benign 0.19
IGL03039:Cfh APN 1 140136261 missense possibly damaging 0.86
IGL03069:Cfh APN 1 140099055 intron probably benign
IGL03192:Cfh APN 1 140099021 missense possibly damaging 0.71
IGL03201:Cfh APN 1 140102819 missense probably damaging 1.00
3-1:Cfh UTSW 1 140163125 missense probably damaging 1.00
PIT4449001:Cfh UTSW 1 140112565 missense probably damaging 1.00
R0257:Cfh UTSW 1 140144035 missense probably benign 0.01
R0294:Cfh UTSW 1 140183261 missense probably benign 0.01
R0571:Cfh UTSW 1 140102333 splice site probably null
R0576:Cfh UTSW 1 140136815 missense probably damaging 0.99
R0586:Cfh UTSW 1 140183182 missense probably damaging 0.98
R0605:Cfh UTSW 1 140102358 missense probably damaging 1.00
R0617:Cfh UTSW 1 140100883 missense probably benign 0.01
R0725:Cfh UTSW 1 140157343 splice site probably benign
R0853:Cfh UTSW 1 140105490 missense probably damaging 1.00
R1430:Cfh UTSW 1 140102698 splice site probably benign
R1500:Cfh UTSW 1 140100876 missense probably damaging 1.00
R1533:Cfh UTSW 1 140100978 missense possibly damaging 0.86
R1667:Cfh UTSW 1 140105523 missense probably benign 0.01
R1695:Cfh UTSW 1 140102837 missense probably damaging 0.98
R1728:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1729:Cfh UTSW 1 140136788 missense probably benign 0.02
R1729:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1730:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1739:Cfh UTSW 1 140136788 missense probably benign 0.02
R1739:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1756:Cfh UTSW 1 140100877 missense probably damaging 1.00
R1762:Cfh UTSW 1 140136788 missense probably benign 0.02
R1762:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1783:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1784:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1785:Cfh UTSW 1 140136788 missense probably benign 0.02
R1785:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R2273:Cfh UTSW 1 140102825 missense probably damaging 1.00
R2288:Cfh UTSW 1 140098901 missense possibly damaging 0.70
R3725:Cfh UTSW 1 140086496 missense probably damaging 0.99
R3731:Cfh UTSW 1 140119970 missense possibly damaging 0.71
R4060:Cfh UTSW 1 140119926 missense possibly damaging 0.91
R4192:Cfh UTSW 1 140102716 missense possibly damaging 0.50
R4226:Cfh UTSW 1 140108926 missense probably damaging 1.00
R4425:Cfh UTSW 1 140100875 nonsense probably null
R4431:Cfh UTSW 1 140136266 missense probably damaging 1.00
R4712:Cfh UTSW 1 140108536 missense probably damaging 1.00
R4755:Cfh UTSW 1 140088808 missense probably damaging 1.00
R4792:Cfh UTSW 1 140100823 nonsense probably null
R4831:Cfh UTSW 1 140086387 missense probably benign
R5052:Cfh UTSW 1 140144044 missense probably damaging 0.96
R5181:Cfh UTSW 1 140147646 splice site probably benign
R5205:Cfh UTSW 1 140143970 missense probably damaging 1.00
R5285:Cfh UTSW 1 140100898 missense probably benign 0.21
R5366:Cfh UTSW 1 140136235 missense probably damaging 1.00
R5776:Cfh UTSW 1 140144023 missense possibly damaging 0.83
R5914:Cfh UTSW 1 140136229 missense probably benign 0.39
R5948:Cfh UTSW 1 140108808 missense probably damaging 0.96
R5979:Cfh UTSW 1 140118671 missense possibly damaging 0.66
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6059:Cfh UTSW 1 140118690 missense possibly damaging 0.92
R6198:Cfh UTSW 1 140105440 missense probably damaging 1.00
R6306:Cfh UTSW 1 140102417 missense probably damaging 1.00
R6523:Cfh UTSW 1 140101707 missense possibly damaging 0.82
R6610:Cfh UTSW 1 140101748 nonsense probably null
R6652:Cfh UTSW 1 140144068 missense probably benign 0.39
R6852:Cfh UTSW 1 140147749 missense probably damaging 1.00
R6861:Cfh UTSW 1 140100883 missense probably benign 0.07
R6862:Cfh UTSW 1 140102362 missense probably damaging 1.00
R7065:Cfh UTSW 1 140086402 missense probably damaging 0.99
R7191:Cfh UTSW 1 140112567 missense probably benign 0.04
R7197:Cfh UTSW 1 140088767 nonsense probably null
R7355:Cfh UTSW 1 140136815 missense probably damaging 1.00
R7367:Cfh UTSW 1 140086521 missense probably damaging 0.97
R7419:Cfh UTSW 1 140105466 missense probably damaging 0.99
R7579:Cfh UTSW 1 140108590 missense possibly damaging 0.53
R7586:Cfh UTSW 1 140147721 missense probably damaging 0.99
R8119:Cfh UTSW 1 140120015 missense possibly damaging 0.95
R8277:Cfh UTSW 1 140101609 missense probably damaging 1.00
T0975:Cfh UTSW 1 140154598 missense probably benign 0.05
Z1088:Cfh UTSW 1 140108904 missense probably benign 0.04
Z1088:Cfh UTSW 1 140147718 missense possibly damaging 0.77
Z1177:Cfh UTSW 1 140144059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAATGCACAGTAAGCTAAAAGC -3'
(R):5'- TGCATGCTCATTAAACAGCTGG -3'

Sequencing Primer
(F):5'- CAACTAGGAGTGTTTAGGTTG -3'
(R):5'- GCTCATTAAACAGCTGGAAAGATAAC -3'
Posted On2014-06-30