Incidental Mutation 'R1912:Cacna1e'
ID 210344
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Name calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms Cav2.3, Cchra1, alpha1E
MMRRC Submission 039930-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R1912 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 154266477-154760247 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 154312195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1290 (I1290T)
Ref Sequence ENSEMBL: ENSMUSP00000004214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000004214
AA Change: I1290T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: I1290T

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187541
AA Change: I1598T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: I1598T

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211821
AA Change: I1536T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,288,582 (GRCm39) M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 (GRCm39) I45N possibly damaging Het
Abcb6 A G 1: 75,156,599 (GRCm39) V55A probably benign Het
Adam28 A T 14: 68,881,780 (GRCm39) D105E probably benign Het
Ahnak T C 19: 8,995,245 (GRCm39) S5510P probably damaging Het
Aldh3b1 T G 19: 3,971,187 (GRCm39) D159A probably damaging Het
Alx1 A G 10: 102,861,222 (GRCm39) L102P probably damaging Het
Ankrd50 C T 3: 38,510,925 (GRCm39) V481I probably benign Het
Aox4 G T 1: 58,303,561 (GRCm39) G1200W probably damaging Het
Arhgap45 A C 10: 79,856,524 (GRCm39) D24A probably benign Het
Arhgef16 A T 4: 154,364,780 (GRCm39) probably null Het
Asic4 A T 1: 75,445,876 (GRCm39) Y235F possibly damaging Het
Asph T C 4: 9,453,335 (GRCm39) E646G probably damaging Het
Atg4d A G 9: 21,183,935 (GRCm39) D350G probably damaging Het
Auts2 T C 5: 131,472,412 (GRCm39) T347A probably damaging Het
Bsnd A T 4: 106,345,227 (GRCm39) L73* probably null Het
Cachd1 A T 4: 100,810,366 (GRCm39) S323C probably damaging Het
Cdh8 T A 8: 99,825,502 (GRCm39) N498Y probably damaging Het
Cdkn3 A G 14: 47,007,291 (GRCm39) probably null Het
Celf2 A T 2: 6,620,564 (GRCm39) M40K probably damaging Het
Cfap57 A C 4: 118,472,207 (GRCm39) S57R probably damaging Het
Cfh A G 1: 140,063,879 (GRCm39) probably null Het
Chdh A G 14: 29,754,745 (GRCm39) S252G probably benign Het
Col8a1 T A 16: 57,448,287 (GRCm39) I408F unknown Het
Corin C T 5: 72,515,746 (GRCm39) C303Y probably damaging Het
Crlf2 C T 5: 109,705,007 (GRCm39) C66Y possibly damaging Het
Csmd1 C T 8: 16,284,012 (GRCm39) probably null Het
Cyp4f16 T C 17: 32,764,018 (GRCm39) V270A probably damaging Het
Defa29 T A 8: 21,816,028 (GRCm39) H113L possibly damaging Het
Dhx35 A T 2: 158,684,227 (GRCm39) N501Y probably damaging Het
Dipk1b A G 2: 26,522,716 (GRCm39) E55G probably damaging Het
Dst A G 1: 34,330,931 (GRCm39) R4690G probably damaging Het
Elac2 T A 11: 64,885,089 (GRCm39) D439E probably benign Het
Ercc6 A G 14: 32,298,760 (GRCm39) R1383G probably damaging Het
Fat3 T A 9: 15,881,284 (GRCm39) Y3196F probably damaging Het
Fbxw13 A T 9: 109,010,611 (GRCm39) D342E probably benign Het
Fmod A G 1: 133,968,458 (GRCm39) N166S possibly damaging Het
Folh1 A G 7: 86,412,175 (GRCm39) S199P possibly damaging Het
Fv1 A G 4: 147,954,235 (GRCm39) N267S possibly damaging Het
Fyn T C 10: 39,402,828 (GRCm39) V200A possibly damaging Het
Gfus A T 15: 75,797,498 (GRCm39) D278E possibly damaging Het
Ggnbp2 T C 11: 84,753,122 (GRCm39) N39S probably benign Het
Gm10509 A T 17: 21,909,831 (GRCm39) I53F possibly damaging Het
Gpr139 A T 7: 118,744,102 (GRCm39) I161N possibly damaging Het
Grhl2 C T 15: 37,358,651 (GRCm39) T148I probably damaging Het
Hmcn1 C A 1: 150,480,633 (GRCm39) M4514I probably benign Het
Igsf10 T G 3: 59,236,993 (GRCm39) T1063P probably benign Het
Itgav A G 2: 83,625,830 (GRCm39) Y792C possibly damaging Het
Itgb2l T C 16: 96,228,135 (GRCm39) Q456R probably benign Het
Jph4 G A 14: 55,345,818 (GRCm39) A613V probably benign Het
Kcna2 A G 3: 107,012,717 (GRCm39) T433A probably benign Het
Kmt2e A G 5: 23,697,393 (GRCm39) K97R probably benign Het
Krba1 C A 6: 48,392,699 (GRCm39) A871E probably benign Het
Loxhd1 T C 18: 77,427,833 (GRCm39) F468L probably benign Het
Lpin1 A G 12: 16,596,728 (GRCm39) V713A probably damaging Het
Ltbp2 T A 12: 84,832,637 (GRCm39) I67F probably damaging Het
Mdc1 G A 17: 36,155,430 (GRCm39) R35H probably benign Het
Mdc1 A G 17: 36,161,703 (GRCm39) D872G probably benign Het
Mgam C T 6: 40,741,119 (GRCm39) Q959* probably null Het
Mttp T A 3: 137,821,788 (GRCm39) T260S probably benign Het
Naalad2 A T 9: 18,287,831 (GRCm39) D266E probably benign Het
Nans T A 4: 46,500,162 (GRCm39) L182H probably damaging Het
Nbas T A 12: 13,616,145 (GRCm39) C2228S probably benign Het
Nfix A T 8: 85,448,306 (GRCm39) V407E probably damaging Het
Nktr T A 9: 121,579,306 (GRCm39) probably benign Het
Nlrp10 G A 7: 108,524,602 (GRCm39) R293* probably null Het
Nrxn3 T C 12: 88,762,112 (GRCm39) F53S probably damaging Het
Or11h4 G A 14: 50,974,235 (GRCm39) P128L probably damaging Het
Or12e7 T C 2: 87,287,727 (GRCm39) S73P probably damaging Het
Or1e21 A T 11: 73,344,820 (GRCm39) F73I probably damaging Het
Or2f2 T C 6: 42,767,411 (GRCm39) I146T probably benign Het
Or3a1c T C 11: 74,046,711 (GRCm39) C244R probably damaging Het
Or5ak24 T A 2: 85,260,604 (GRCm39) N190Y probably damaging Het
Or5p68 A G 7: 107,946,014 (GRCm39) L58P probably damaging Het
Or6d12 A G 6: 116,492,950 (GRCm39) T71A probably benign Het
Oxld1 A G 11: 120,347,732 (GRCm39) V155A probably damaging Het
Pamr1 T A 2: 102,472,645 (GRCm39) F648Y probably damaging Het
Parg T C 14: 31,932,497 (GRCm39) W446R probably damaging Het
Pate13 A T 9: 35,819,915 (GRCm39) T23S probably benign Het
Phf3 A T 1: 30,843,426 (GRCm39) H1844Q probably damaging Het
Phf7 T C 14: 30,962,281 (GRCm39) I175V possibly damaging Het
Pibf1 G A 14: 99,425,245 (GRCm39) probably null Het
Plcxd1 A G 5: 110,251,308 (GRCm39) I295V probably benign Het
Pole2 A C 12: 69,256,764 (GRCm39) Y254D probably damaging Het
Ppm1e T A 11: 87,135,196 (GRCm39) I225F probably benign Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Resf1 T A 6: 149,230,342 (GRCm39) D1129E possibly damaging Het
Rnase2b T G 14: 51,400,357 (GRCm39) V146G probably damaging Het
Rnf169 G A 7: 99,575,461 (GRCm39) T378I probably damaging Het
Rpf2 A G 10: 40,112,197 (GRCm39) F80L probably benign Het
Sec11c T A 18: 65,947,945 (GRCm39) D128E probably damaging Het
Septin12 A G 16: 4,806,417 (GRCm39) V248A probably damaging Het
Serinc1 T C 10: 57,401,547 (GRCm39) N82S probably benign Het
Serpina9 A C 12: 103,967,508 (GRCm39) W296G probably damaging Het
Sgo2b A C 8: 64,384,503 (GRCm39) D164E probably damaging Het
Slc15a3 A G 19: 10,825,977 (GRCm39) N223D probably damaging Het
Slc44a3 A G 3: 121,325,815 (GRCm39) Y12H probably benign Het
Slco3a1 A G 7: 74,154,359 (GRCm39) F42S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx7 A T 3: 117,623,317 (GRCm39) probably null Het
Sorl1 A T 9: 41,993,246 (GRCm39) D259E probably damaging Het
Stpg2 G A 3: 139,228,742 (GRCm39) probably null Het
Strn T A 17: 78,991,824 (GRCm39) Y165F probably damaging Het
Sval2 T A 6: 41,841,254 (GRCm39) *106R probably null Het
Tcaf3 A G 6: 42,573,622 (GRCm39) S197P possibly damaging Het
Tespa1 C A 10: 130,190,592 (GRCm39) T73N probably benign Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Thoc5 C A 11: 4,865,561 (GRCm39) T380K probably benign Het
Tmprss7 T A 16: 45,476,911 (GRCm39) R784* probably null Het
Trank1 A T 9: 111,219,777 (GRCm39) L2171F probably benign Het
Trpm2 T G 10: 77,781,710 (GRCm39) K303T probably benign Het
Unc80 G A 1: 66,549,784 (GRCm39) V681M probably damaging Het
Usp40 A G 1: 87,874,368 (GRCm39) F1131L probably benign Het
Vmn1r215 A T 13: 23,260,673 (GRCm39) I238F possibly damaging Het
Vwa3a A T 7: 120,394,850 (GRCm39) Y890F probably damaging Het
Zdhhc18 A G 4: 133,341,171 (GRCm39) L234P probably damaging Het
Zfp109 A G 7: 23,927,676 (GRCm39) S578P probably damaging Het
Zfp704 T C 3: 9,674,418 (GRCm39) D121G unknown Het
Zgrf1 G T 3: 127,356,786 (GRCm39) V671L probably benign Het
Zkscan8 A T 13: 21,704,927 (GRCm39) C265* probably null Het
Zscan26 T C 13: 21,629,310 (GRCm39) I398V possibly damaging Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154,279,429 (GRCm39) missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154,347,347 (GRCm39) missense probably benign 0.04
IGL01302:Cacna1e APN 1 154,319,653 (GRCm39) missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154,348,123 (GRCm39) missense probably benign 0.18
IGL01573:Cacna1e APN 1 154,347,113 (GRCm39) missense probably benign
IGL01676:Cacna1e APN 1 154,288,196 (GRCm39) missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154,274,222 (GRCm39) missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154,347,119 (GRCm39) missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154,347,086 (GRCm39) missense probably null 0.00
IGL01895:Cacna1e APN 1 154,319,646 (GRCm39) missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154,296,859 (GRCm39) missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154,279,493 (GRCm39) missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154,302,274 (GRCm39) missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154,369,155 (GRCm39) missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154,321,394 (GRCm39) missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154,341,487 (GRCm39) missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154,347,171 (GRCm39) missense probably benign 0.15
IGL03120:Cacna1e APN 1 154,319,627 (GRCm39) missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154,369,104 (GRCm39) missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154,317,997 (GRCm39) missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154,342,690 (GRCm39) critical splice donor site probably null
bezoar UTSW 1 154,312,300 (GRCm39) splice site probably null
hairball UTSW 1 154,355,051 (GRCm39) missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154,341,510 (GRCm39) missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154,319,647 (GRCm39) missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154,324,693 (GRCm39) splice site probably null
R0314:Cacna1e UTSW 1 154,317,997 (GRCm39) missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154,291,884 (GRCm39) missense probably benign 0.03
R0626:Cacna1e UTSW 1 154,364,563 (GRCm39) missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154,318,024 (GRCm39) missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154,320,714 (GRCm39) missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154,274,419 (GRCm39) missense probably benign
R1340:Cacna1e UTSW 1 154,348,403 (GRCm39) missense probably damaging 1.00
R1440:Cacna1e UTSW 1 154,437,552 (GRCm39) missense possibly damaging 0.63
R1449:Cacna1e UTSW 1 154,361,408 (GRCm39) critical splice donor site probably null
R1538:Cacna1e UTSW 1 154,437,504 (GRCm39) missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154,353,525 (GRCm39) missense probably benign 0.01
R1560:Cacna1e UTSW 1 154,296,850 (GRCm39) nonsense probably null
R1748:Cacna1e UTSW 1 154,362,315 (GRCm39) missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154,319,746 (GRCm39) missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154,576,240 (GRCm39) missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154,353,563 (GRCm39) missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154,353,563 (GRCm39) missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154,319,591 (GRCm39) missense probably damaging 1.00
R2291:Cacna1e UTSW 1 154,279,429 (GRCm39) missense probably damaging 0.99
R2417:Cacna1e UTSW 1 154,347,939 (GRCm39) missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154,291,831 (GRCm39) missense probably benign 0.08
R3757:Cacna1e UTSW 1 154,509,442 (GRCm39) missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154,359,299 (GRCm39) missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154,358,331 (GRCm39) missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154,287,929 (GRCm39) splice site probably null
R4275:Cacna1e UTSW 1 154,369,071 (GRCm39) missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154,302,296 (GRCm39) missense probably benign 0.04
R4297:Cacna1e UTSW 1 154,274,477 (GRCm39) missense probably benign 0.37
R4356:Cacna1e UTSW 1 154,319,727 (GRCm39) missense probably damaging 1.00
R4510:Cacna1e UTSW 1 154,437,579 (GRCm39) missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154,437,579 (GRCm39) missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154,277,773 (GRCm39) missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154,312,265 (GRCm39) missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154,347,359 (GRCm39) missense probably benign
R4622:Cacna1e UTSW 1 154,347,311 (GRCm39) missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154,358,294 (GRCm39) splice site probably null
R4694:Cacna1e UTSW 1 154,313,012 (GRCm39) critical splice donor site probably null
R4727:Cacna1e UTSW 1 154,312,214 (GRCm39) nonsense probably null
R4839:Cacna1e UTSW 1 154,296,804 (GRCm39) missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154,312,300 (GRCm39) splice site probably null
R4894:Cacna1e UTSW 1 154,364,551 (GRCm39) nonsense probably null
R4934:Cacna1e UTSW 1 154,357,380 (GRCm39) nonsense probably null
R4979:Cacna1e UTSW 1 154,289,739 (GRCm39) missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154,437,475 (GRCm39) critical splice donor site probably null
R5128:Cacna1e UTSW 1 154,277,767 (GRCm39) missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154,577,110 (GRCm39) missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154,576,250 (GRCm39) missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154,353,542 (GRCm39) missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154,341,525 (GRCm39) missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154,319,683 (GRCm39) missense probably damaging 1.00
R5475:Cacna1e UTSW 1 154,601,455 (GRCm39) missense possibly damaging 0.53
R5607:Cacna1e UTSW 1 154,347,086 (GRCm39) missense probably benign 0.00
R5615:Cacna1e UTSW 1 154,287,916 (GRCm39) missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154,317,940 (GRCm39) missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154,511,604 (GRCm39) missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154,509,463 (GRCm39) missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154,347,383 (GRCm39) missense probably benign 0.00
R5893:Cacna1e UTSW 1 154,313,069 (GRCm39) missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154,437,537 (GRCm39) missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154,577,037 (GRCm39) missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154,362,316 (GRCm39) missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154,301,678 (GRCm39) missense probably benign 0.38
R6295:Cacna1e UTSW 1 154,317,919 (GRCm39) missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154,301,678 (GRCm39) missense probably benign 0.38
R6320:Cacna1e UTSW 1 154,317,270 (GRCm39) missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154,355,051 (GRCm39) missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154,289,720 (GRCm39) critical splice donor site probably null
R6842:Cacna1e UTSW 1 154,358,863 (GRCm39) missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154,601,439 (GRCm39) missense probably null 0.85
R7081:Cacna1e UTSW 1 154,576,129 (GRCm39) missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154,349,492 (GRCm39) splice site probably null
R7108:Cacna1e UTSW 1 154,344,741 (GRCm39) frame shift probably null
R7142:Cacna1e UTSW 1 154,288,230 (GRCm39) missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154,576,235 (GRCm39) missense possibly damaging 0.93
R7332:Cacna1e UTSW 1 154,601,547 (GRCm39) missense possibly damaging 0.89
R7410:Cacna1e UTSW 1 154,347,980 (GRCm39) missense probably benign 0.13
R7502:Cacna1e UTSW 1 154,344,734 (GRCm39) missense probably null 0.35
R7556:Cacna1e UTSW 1 154,348,419 (GRCm39) missense probably benign 0.28
R7563:Cacna1e UTSW 1 154,347,162 (GRCm39) missense probably benign 0.00
R7573:Cacna1e UTSW 1 154,601,911 (GRCm39) intron probably benign
R7689:Cacna1e UTSW 1 154,274,549 (GRCm39) missense probably benign 0.01
R7699:Cacna1e UTSW 1 154,319,674 (GRCm39) missense probably damaging 1.00
R7744:Cacna1e UTSW 1 154,341,538 (GRCm39) missense probably damaging 1.00
R7754:Cacna1e UTSW 1 154,288,863 (GRCm39) missense probably damaging 0.97
R7787:Cacna1e UTSW 1 154,358,314 (GRCm39) missense probably damaging 0.98
R7818:Cacna1e UTSW 1 154,274,152 (GRCm39) missense probably damaging 1.00
R7838:Cacna1e UTSW 1 154,347,149 (GRCm39) missense probably benign 0.08
R7849:Cacna1e UTSW 1 154,509,464 (GRCm39) missense probably damaging 1.00
R8011:Cacna1e UTSW 1 154,341,568 (GRCm39) missense probably benign 0.01
R8094:Cacna1e UTSW 1 154,437,516 (GRCm39) missense probably damaging 1.00
R8162:Cacna1e UTSW 1 154,577,313 (GRCm39) splice site probably null
R8202:Cacna1e UTSW 1 154,274,195 (GRCm39) missense probably benign
R8280:Cacna1e UTSW 1 154,344,839 (GRCm39) missense probably damaging 0.97
R8354:Cacna1e UTSW 1 154,274,314 (GRCm39) missense probably damaging 1.00
R8385:Cacna1e UTSW 1 154,319,687 (GRCm39) missense probably damaging 0.98
R8532:Cacna1e UTSW 1 154,341,510 (GRCm39) missense probably damaging 1.00
R8902:Cacna1e UTSW 1 154,349,632 (GRCm39) missense probably benign 0.01
R8926:Cacna1e UTSW 1 154,577,080 (GRCm39) missense possibly damaging 0.84
R8947:Cacna1e UTSW 1 154,277,896 (GRCm39) missense probably benign 0.10
R9094:Cacna1e UTSW 1 154,355,064 (GRCm39) missense possibly damaging 0.93
R9126:Cacna1e UTSW 1 154,343,510 (GRCm39) missense probably benign 0.01
R9175:Cacna1e UTSW 1 154,274,314 (GRCm39) missense probably damaging 1.00
R9286:Cacna1e UTSW 1 154,288,845 (GRCm39) missense probably damaging 1.00
R9377:Cacna1e UTSW 1 154,361,458 (GRCm39) missense possibly damaging 0.88
R9452:Cacna1e UTSW 1 154,289,720 (GRCm39) critical splice donor site probably null
R9463:Cacna1e UTSW 1 154,357,411 (GRCm39) missense probably damaging 1.00
R9513:Cacna1e UTSW 1 154,318,033 (GRCm39) missense probably damaging 1.00
R9534:Cacna1e UTSW 1 154,320,693 (GRCm39) missense possibly damaging 0.65
R9562:Cacna1e UTSW 1 154,283,486 (GRCm39) missense probably benign 0.01
RF008:Cacna1e UTSW 1 154,317,882 (GRCm39) missense probably damaging 1.00
X0062:Cacna1e UTSW 1 154,288,238 (GRCm39) missense probably damaging 1.00
Z1176:Cacna1e UTSW 1 154,511,596 (GRCm39) missense probably damaging 0.98
Z1177:Cacna1e UTSW 1 154,318,038 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTATCCAGCCAGCCTG -3'
(R):5'- GACTGCCATCTATTTTGTGATCTG -3'

Sequencing Primer
(F):5'- GCCTGCGCTATAATCAAGAACTATTG -3'
(R):5'- TGTGATCTGAATAAGGAATAAATGCG -3'
Posted On 2014-06-30