Mutagenetix > Incidental Mutation

Incidental Mutation 'R1912:Itgav'

210347

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

039930-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1912 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83795486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 792 (Y792C)

Ref Sequence

ENSEMBL: ENSMUSP00000028499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028499
AA Change: Y792C

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: Y792C

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111740
AA Change: Y756C

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: Y756C

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
2810474O19Rik	T	A	6: 149,328,844	D1129E	possibly damaging	Het
2900092C05Rik	A	G	7: 12,554,655	M132V	probably benign	Het
4921524L21Rik	T	A	18: 6,620,205	I45N	possibly damaging	Het
9230113P08Rik	A	T	9: 35,908,619	T23S	probably benign	Het
Abcb6	A	G	1: 75,179,955	V55A	probably benign	Het
Adam28	A	T	14: 68,644,331	D105E	probably benign	Het
Ahnak	T	C	19: 9,017,881	S5510P	probably damaging	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Alx1	A	G	10: 103,025,361	L102P	probably damaging	Het
Ankrd50	C	T	3: 38,456,776	V481I	probably benign	Het
Aox4	G	T	1: 58,264,402	G1200W	probably damaging	Het
Arhgap45	A	C	10: 80,020,690	D24A	probably benign	Het
Arhgef16	A	T	4: 154,280,323		probably null	Het
Asic4	A	T	1: 75,469,232	Y235F	possibly damaging	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Atg4d	A	G	9: 21,272,639	D350G	probably damaging	Het
Auts2	T	C	5: 131,443,574	T347A	probably damaging	Het
Bsnd	A	T	4: 106,488,030	L73*	probably null	Het
Cachd1	A	T	4: 100,953,169	S323C	probably damaging	Het
Cacna1e	A	G	1: 154,436,449	I1290T	probably damaging	Het
Cdh8	T	A	8: 99,098,870	N498Y	probably damaging	Het
Cdkn3	A	G	14: 46,769,834		probably null	Het
Celf2	A	T	2: 6,615,753	M40K	probably damaging	Het
Cfap57	A	C	4: 118,615,010	S57R	probably damaging	Het
Cfh	A	G	1: 140,136,141		probably null	Het
Chdh	A	G	14: 30,032,788	S252G	probably benign	Het
Col8a1	T	A	16: 57,627,924	I408F	unknown	Het
Corin	C	T	5: 72,358,403	C303Y	probably damaging	Het
Crlf2	C	T	5: 109,557,141	C66Y	possibly damaging	Het
Csmd1	C	T	8: 16,233,998		probably null	Het
Cyp4f16	T	C	17: 32,545,044	V270A	probably damaging	Het
Defa29	T	A	8: 21,326,012	H113L	possibly damaging	Het
Dhx35	A	T	2: 158,842,307	N501Y	probably damaging	Het
Dst	A	G	1: 34,291,850	R4690G	probably damaging	Het
Elac2	T	A	11: 64,994,263	D439E	probably benign	Het
Ercc6	A	G	14: 32,576,803	R1383G	probably damaging	Het
Fam69b	A	G	2: 26,632,704	E55G	probably damaging	Het
Fat3	T	A	9: 15,969,988	Y3196F	probably damaging	Het
Fbxw13	A	T	9: 109,181,543	D342E	probably benign	Het
Fmod	A	G	1: 134,040,720	N166S	possibly damaging	Het
Folh1	A	G	7: 86,762,967	S199P	possibly damaging	Het
Fv1	A	G	4: 147,869,778	N267S	possibly damaging	Het
Fyn	T	C	10: 39,526,832	V200A	possibly damaging	Het
Ggnbp2	T	C	11: 84,862,296	N39S	probably benign	Het
Gm10509	A	T	17: 21,690,924	I53F	possibly damaging	Het
Gpr139	A	T	7: 119,144,879	I161N	possibly damaging	Het
Grhl2	C	T	15: 37,358,407	T148I	probably damaging	Het
Hmcn1	C	A	1: 150,604,882	M4514I	probably benign	Het
Igsf10	T	G	3: 59,329,572	T1063P	probably benign	Het
Itgb2l	T	C	16: 96,426,935	Q456R	probably benign	Het
Jph4	G	A	14: 55,108,361	A613V	probably benign	Het
Kcna2	A	G	3: 107,105,401	T433A	probably benign	Het
Kmt2e	A	G	5: 23,492,395	K97R	probably benign	Het
Krba1	C	A	6: 48,415,765	A871E	probably benign	Het
Loxhd1	T	C	18: 77,340,137	F468L	probably benign	Het
Lpin1	A	G	12: 16,546,727	V713A	probably damaging	Het
Ltbp2	T	A	12: 84,785,863	I67F	probably damaging	Het
Mdc1	G	A	17: 35,844,538	R35H	probably benign	Het
Mdc1	A	G	17: 35,850,811	D872G	probably benign	Het
Mgam	C	T	6: 40,764,185	Q959*	probably null	Het
Mttp	T	A	3: 138,116,027	T260S	probably benign	Het
Naalad2	A	T	9: 18,376,535	D266E	probably benign	Het
Nans	T	A	4: 46,500,162	L182H	probably damaging	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nfix	A	T	8: 84,721,677	V407E	probably damaging	Het
Nktr	T	A	9: 121,750,240		probably benign	Het
Nlrp10	G	A	7: 108,925,395	R293*	probably null	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1126	T	C	2: 87,457,383	S73P	probably damaging	Het
Olfr212	A	G	6: 116,515,989	T71A	probably benign	Het
Olfr380	A	T	11: 73,453,994	F73I	probably damaging	Het
Olfr402	T	C	11: 74,155,885	C244R	probably damaging	Het
Olfr452	T	C	6: 42,790,477	I146T	probably benign	Het
Olfr493	A	G	7: 108,346,807	L58P	probably damaging	Het
Olfr749	G	A	14: 50,736,778	P128L	probably damaging	Het
Olfr994	T	A	2: 85,430,260	N190Y	probably damaging	Het
Oxld1	A	G	11: 120,456,906	V155A	probably damaging	Het
Pamr1	T	A	2: 102,642,300	F648Y	probably damaging	Het
Parg	T	C	14: 32,210,540	W446R	probably damaging	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Phf7	T	C	14: 31,240,324	I175V	possibly damaging	Het
Pibf1	G	A	14: 99,187,809		probably null	Het
Plcxd1	A	G	5: 110,103,442	I295V	probably benign	Het
Pole2	A	C	12: 69,209,990	Y254D	probably damaging	Het
Ppm1e	T	A	11: 87,244,370	I225F	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnase2b	T	G	14: 51,162,900	V146G	probably damaging	Het
Rnf169	G	A	7: 99,926,254	T378I	probably damaging	Het
Rpf2	A	G	10: 40,236,201	F80L	probably benign	Het
Sec11c	T	A	18: 65,814,874	D128E	probably damaging	Het
Sept12	A	G	16: 4,988,553	V248A	probably damaging	Het
Serinc1	T	C	10: 57,525,451	N82S	probably benign	Het
Serpina9	A	C	12: 104,001,249	W296G	probably damaging	Het
Sgo2b	A	C	8: 63,931,469	D164E	probably damaging	Het
Slc15a3	A	G	19: 10,848,613	N223D	probably damaging	Het
Slc44a3	A	G	3: 121,532,166	Y12H	probably benign	Het
Slco3a1	A	G	7: 74,504,611	F42S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Sorl1	A	T	9: 42,081,950	D259E	probably damaging	Het
Stpg2	G	A	3: 139,522,981		probably null	Het
Strn	T	A	17: 78,684,395	Y165F	probably damaging	Het
Sval2	T	A	6: 41,864,320	*106R	probably null	Het
Tcaf3	A	G	6: 42,596,688	S197P	possibly damaging	Het
Tespa1	C	A	10: 130,354,723	T73N	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Thoc5	C	A	11: 4,915,561	T380K	probably benign	Het
Tmprss7	T	A	16: 45,656,548	R784*	probably null	Het
Trank1	A	T	9: 111,390,709	L2171F	probably benign	Het
Trpm2	T	G	10: 77,945,876	K303T	probably benign	Het
Tsta3	A	T	15: 75,925,649	D278E	possibly damaging	Het
Unc80	G	A	1: 66,510,625	V681M	probably damaging	Het
Usp40	A	G	1: 87,946,646	F1131L	probably benign	Het
Vmn1r215	A	T	13: 23,076,503	I238F	possibly damaging	Het
Vwa3a	A	T	7: 120,795,627	Y890F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,860	L234P	probably damaging	Het
Zfp109	A	G	7: 24,228,251	S578P	probably damaging	Het
Zfp704	T	C	3: 9,609,358	D121G	unknown	Het
Zgrf1	G	T	3: 127,563,137	V671L	probably benign	Het
Zkscan8	A	T	13: 21,520,757	C265*	probably null	Het
Zscan26	T	C	13: 21,445,140	I398V	possibly damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CTAGTTCATCTGTTGCATGCTG -3'
(R):5'- CTTCTGGTACATGTTTACACTATGC -3'

Sequencing Primer
(F):5'- CTGATTTAGCAACGGTGGC -3'
(R):5'- GTACATGTTTACACTATGCAAATTGC -3'

Posted On

2014-06-30