Incidental Mutation 'R0121:Arfip2'
ID21035
Institutional Source Beutler Lab
Gene Symbol Arfip2
Ensembl Gene ENSMUSG00000030881
Gene NameADP-ribosylation factor interacting protein 2
Synonyms2310002N04Rik, Arfaptin 2
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location105634203-105640416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105636371 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 224 (L224P)
Ref Sequence ENSEMBL: ENSMUSP00000147995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033171] [ENSMUST00000057525] [ENSMUST00000058333] [ENSMUST00000084782] [ENSMUST00000106780] [ENSMUST00000106783] [ENSMUST00000106784] [ENSMUST00000106785] [ENSMUST00000106786] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000131446] [ENSMUST00000133519] [ENSMUST00000137931] [ENSMUST00000140577] [ENSMUST00000142363] [ENSMUST00000142874] [ENSMUST00000147044] [ENSMUST00000149819] [ENSMUST00000150479] [ENSMUST00000151193] [ENSMUST00000153371] [ENSMUST00000157028] [ENSMUST00000209445] [ENSMUST00000209550] [ENSMUST00000209588] [ENSMUST00000210312] [ENSMUST00000210350] [ENSMUST00000210911] [ENSMUST00000211054]
Predicted Effect probably benign
Transcript: ENSMUST00000033171
SMART Domains Protein: ENSMUSP00000033171
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057525
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058333
SMART Domains Protein: ENSMUSP00000057061
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084782
AA Change: L298P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081840
Gene: ENSMUSG00000030881
AA Change: L298P

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106780
SMART Domains Protein: ENSMUSP00000102392
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106783
SMART Domains Protein: ENSMUSP00000102395
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106784
Predicted Effect probably benign
Transcript: ENSMUST00000106785
SMART Domains Protein: ENSMUSP00000102397
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106786
SMART Domains Protein: ENSMUSP00000102398
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 3 66 3.6e-18 PFAM
low complexity region 89 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106789
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127853
Predicted Effect probably damaging
Transcript: ENSMUST00000131446
AA Change: L298P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120387
Gene: ENSMUSG00000030881
AA Change: L298P

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133519
SMART Domains Protein: ENSMUSP00000121649
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 209 5.49e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134613
Predicted Effect probably benign
Transcript: ENSMUST00000137931
SMART Domains Protein: ENSMUSP00000118616
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Pfam:Arfaptin 89 153 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140385
Predicted Effect probably benign
Transcript: ENSMUST00000140577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142173
Predicted Effect probably benign
Transcript: ENSMUST00000142363
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably benign
Transcript: ENSMUST00000147044
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149819
Predicted Effect probably benign
Transcript: ENSMUST00000150479
Predicted Effect probably benign
Transcript: ENSMUST00000151193
Predicted Effect probably benign
Transcript: ENSMUST00000153371
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000157028
Predicted Effect probably benign
Transcript: ENSMUST00000209445
Predicted Effect probably damaging
Transcript: ENSMUST00000209550
AA Change: L294P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209588
Predicted Effect probably benign
Transcript: ENSMUST00000209870
Predicted Effect probably benign
Transcript: ENSMUST00000210312
Predicted Effect probably benign
Transcript: ENSMUST00000210350
Predicted Effect probably benign
Transcript: ENSMUST00000210893
Predicted Effect probably damaging
Transcript: ENSMUST00000210911
AA Change: L224P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211054
Meta Mutation Damage Score 0.9658 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Arfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Arfip2 APN 7 105639383 missense probably damaging 1.00
IGL03192:Arfip2 APN 7 105637943 missense probably damaging 1.00
IGL03299:Arfip2 APN 7 105637943 missense probably damaging 1.00
R0096:Arfip2 UTSW 7 105638230 missense probably damaging 1.00
R0130:Arfip2 UTSW 7 105638998 unclassified probably benign
R0152:Arfip2 UTSW 7 105637223 missense probably damaging 1.00
R0317:Arfip2 UTSW 7 105637223 missense probably damaging 1.00
R2172:Arfip2 UTSW 7 105637988 missense probably damaging 1.00
R4419:Arfip2 UTSW 7 105639063 missense probably damaging 1.00
R4926:Arfip2 UTSW 7 105637944 missense probably damaging 1.00
R5394:Arfip2 UTSW 7 105636976 nonsense probably null
R5637:Arfip2 UTSW 7 105637163 missense probably damaging 1.00
Z1088:Arfip2 UTSW 7 105637242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTAAGTGGCAAAGGACATCCC -3'
(R):5'- AACCTGAGCACTTTCAGTTCACCC -3'

Sequencing Primer
(F):5'- GACATCCCATGTCCAATCTCC -3'
(R):5'- CCCAGCAGATTAAGTCAGGTTTC -3'
Posted On2013-04-11