Incidental Mutation 'R0121:Sbf2'
ID21036
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene NameSET binding factor 2
SynonymsmMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
MMRRC Submission 038406-MU
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R0121 (G1)
Quality Score224
Status Validated (trace)
Chromosome7
Chromosomal Location110308013-110614922 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 110489219 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000167652] [ENSMUST00000171218]
Predicted Effect probably null
Transcript: ENSMUST00000033058
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164759
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165449
Predicted Effect probably benign
Transcript: ENSMUST00000166020
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167880
Predicted Effect probably null
Transcript: ENSMUST00000171218
SMART Domains Protein: ENSMUSP00000129805
Gene: ENSMUSG00000038371

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 407 1.5e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171378
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110428346 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6142:Sbf2 UTSW 7 110348975 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R6986:Sbf2 UTSW 7 110330615 missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110614716 nonsense probably null
R7556:Sbf2 UTSW 7 110314053 missense probably benign 0.20
R7604:Sbf2 UTSW 7 110378067 missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 110330713 critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110441426 missense probably benign 0.01
R7812:Sbf2 UTSW 7 110449963 missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 110372510 missense probably damaging 1.00
R7932:Sbf2 UTSW 7 110372510 missense probably damaging 1.00
R8026:Sbf2 UTSW 7 110335387 missense probably damaging 1.00
R8048:Sbf2 UTSW 7 110315082 missense probably benign 0.21
RF005:Sbf2 UTSW 7 110317008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGATGCAGATAAGCACTTTGTTCTA -3'
(R):5'- gtgaaccaattttgtagcctcTCAGGTA -3'

Sequencing Primer
(F):5'- acatacacacatacatacacacac -3'
(R):5'- GCGGAAACAGCCAACATT -3'
Posted On2013-04-11