Mutagenetix > Incidental Mutation

Incidental Mutation 'R1912:Asph'

210362

Institutional Source

Beutler Lab

Gene Symbol

Asph

Ensembl Gene

ENSMUSG00000028207

Gene Name

aspartate-beta-hydroxylase

Synonyms

aspartyl beta-hydroxylase, BAH, calsequestrin-binding protein, jumbug, 2310005F16Rik, 3110001L23Rik, junctate, cI-37, Junctin

MMRRC Submission

039930-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1912 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9448069-9669344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9453335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 646 (E646G)

Ref Sequence

ENSEMBL: ENSMUSP00000103976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038841] [ENSMUST00000078139] [ENSMUST00000108339] [ENSMUST00000108340] [ENSMUST00000108348]

AlphaFold

Q8BSY0

Predicted Effect

probably benign
Transcript: ENSMUST00000038841

SMART Domains

Protein: ENSMUSP00000035649
Gene: ENSMUSG00000041216

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
CRAL_TRIO_N	72	97	5.34e-6	SMART
SEC14	118	276	1.98e-36	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078139
AA Change: E729G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: E729G

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Asp-B-Hydro_N	52	307	7e-104	PFAM
Pfam:TPR_6	326	357	4.4e-5	PFAM
Pfam:TPR_16	328	398	1.3e-9	PFAM
Pfam:TPR_2	439	470	2.6e-4	PFAM
Pfam:TPR_8	441	470	1.7e-3	PFAM
Pfam:Asp_Arg_Hydrox	574	728	7.6e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108339
AA Change: E646G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207
AA Change: E646G

Domain	Start	End	E-Value	Type
Pfam:Asp-B-Hydro_N	1	224	1.6e-80	PFAM
Pfam:TPR_6	243	274	1.4e-4	PFAM
Pfam:TPR_16	245	315	2.5e-9	PFAM
Pfam:TPR_2	356	387	7e-4	PFAM
Pfam:Asp_Arg_Hydrox	489	646	5.3e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108340
AA Change: E713G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207
AA Change: E713G

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Asp-B-Hydro_N	52	291	8.6e-96	PFAM
Pfam:TPR_6	310	341	1.9e-4	PFAM
Pfam:TPR_16	312	382	2.9e-9	PFAM
Pfam:TPR_2	423	454	6.8e-4	PFAM
Pfam:Asp_Arg_Hydrox	556	713	3.8e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108348

SMART Domains

Protein: ENSMUSP00000103985
Gene: ENSMUSG00000041216

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
CRAL_TRIO_N	72	97	5.34e-6	SMART
SEC14	118	276	1.98e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151232

Meta Mutation Damage Score

0.4385

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
2810474O19Rik	T	A	6: 149,328,844	D1129E	possibly damaging	Het
2900092C05Rik	A	G	7: 12,554,655	M132V	probably benign	Het
4921524L21Rik	T	A	18: 6,620,205	I45N	possibly damaging	Het
9230113P08Rik	A	T	9: 35,908,619	T23S	probably benign	Het
Abcb6	A	G	1: 75,179,955	V55A	probably benign	Het
Adam28	A	T	14: 68,644,331	D105E	probably benign	Het
Ahnak	T	C	19: 9,017,881	S5510P	probably damaging	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Alx1	A	G	10: 103,025,361	L102P	probably damaging	Het
Ankrd50	C	T	3: 38,456,776	V481I	probably benign	Het
Aox4	G	T	1: 58,264,402	G1200W	probably damaging	Het
Arhgap45	A	C	10: 80,020,690	D24A	probably benign	Het
Arhgef16	A	T	4: 154,280,323		probably null	Het
Asic4	A	T	1: 75,469,232	Y235F	possibly damaging	Het
Atg4d	A	G	9: 21,272,639	D350G	probably damaging	Het
Auts2	T	C	5: 131,443,574	T347A	probably damaging	Het
Bsnd	A	T	4: 106,488,030	L73*	probably null	Het
Cachd1	A	T	4: 100,953,169	S323C	probably damaging	Het
Cacna1e	A	G	1: 154,436,449	I1290T	probably damaging	Het
Cdh8	T	A	8: 99,098,870	N498Y	probably damaging	Het
Cdkn3	A	G	14: 46,769,834		probably null	Het
Celf2	A	T	2: 6,615,753	M40K	probably damaging	Het
Cfap57	A	C	4: 118,615,010	S57R	probably damaging	Het
Cfh	A	G	1: 140,136,141		probably null	Het
Chdh	A	G	14: 30,032,788	S252G	probably benign	Het
Col8a1	T	A	16: 57,627,924	I408F	unknown	Het
Corin	C	T	5: 72,358,403	C303Y	probably damaging	Het
Crlf2	C	T	5: 109,557,141	C66Y	possibly damaging	Het
Csmd1	C	T	8: 16,233,998		probably null	Het
Cyp4f16	T	C	17: 32,545,044	V270A	probably damaging	Het
Defa29	T	A	8: 21,326,012	H113L	possibly damaging	Het
Dhx35	A	T	2: 158,842,307	N501Y	probably damaging	Het
Dst	A	G	1: 34,291,850	R4690G	probably damaging	Het
Elac2	T	A	11: 64,994,263	D439E	probably benign	Het
Ercc6	A	G	14: 32,576,803	R1383G	probably damaging	Het
Fam69b	A	G	2: 26,632,704	E55G	probably damaging	Het
Fat3	T	A	9: 15,969,988	Y3196F	probably damaging	Het
Fbxw13	A	T	9: 109,181,543	D342E	probably benign	Het
Fmod	A	G	1: 134,040,720	N166S	possibly damaging	Het
Folh1	A	G	7: 86,762,967	S199P	possibly damaging	Het
Fv1	A	G	4: 147,869,778	N267S	possibly damaging	Het
Fyn	T	C	10: 39,526,832	V200A	possibly damaging	Het
Ggnbp2	T	C	11: 84,862,296	N39S	probably benign	Het
Gm10509	A	T	17: 21,690,924	I53F	possibly damaging	Het
Gpr139	A	T	7: 119,144,879	I161N	possibly damaging	Het
Grhl2	C	T	15: 37,358,407	T148I	probably damaging	Het
Hmcn1	C	A	1: 150,604,882	M4514I	probably benign	Het
Igsf10	T	G	3: 59,329,572	T1063P	probably benign	Het
Itgav	A	G	2: 83,795,486	Y792C	possibly damaging	Het
Itgb2l	T	C	16: 96,426,935	Q456R	probably benign	Het
Jph4	G	A	14: 55,108,361	A613V	probably benign	Het
Kcna2	A	G	3: 107,105,401	T433A	probably benign	Het
Kmt2e	A	G	5: 23,492,395	K97R	probably benign	Het
Krba1	C	A	6: 48,415,765	A871E	probably benign	Het
Loxhd1	T	C	18: 77,340,137	F468L	probably benign	Het
Lpin1	A	G	12: 16,546,727	V713A	probably damaging	Het
Ltbp2	T	A	12: 84,785,863	I67F	probably damaging	Het
Mdc1	G	A	17: 35,844,538	R35H	probably benign	Het
Mdc1	A	G	17: 35,850,811	D872G	probably benign	Het
Mgam	C	T	6: 40,764,185	Q959*	probably null	Het
Mttp	T	A	3: 138,116,027	T260S	probably benign	Het
Naalad2	A	T	9: 18,376,535	D266E	probably benign	Het
Nans	T	A	4: 46,500,162	L182H	probably damaging	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nfix	A	T	8: 84,721,677	V407E	probably damaging	Het
Nktr	T	A	9: 121,750,240		probably benign	Het
Nlrp10	G	A	7: 108,925,395	R293*	probably null	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1126	T	C	2: 87,457,383	S73P	probably damaging	Het
Olfr212	A	G	6: 116,515,989	T71A	probably benign	Het
Olfr380	A	T	11: 73,453,994	F73I	probably damaging	Het
Olfr402	T	C	11: 74,155,885	C244R	probably damaging	Het
Olfr452	T	C	6: 42,790,477	I146T	probably benign	Het
Olfr493	A	G	7: 108,346,807	L58P	probably damaging	Het
Olfr749	G	A	14: 50,736,778	P128L	probably damaging	Het
Olfr994	T	A	2: 85,430,260	N190Y	probably damaging	Het
Oxld1	A	G	11: 120,456,906	V155A	probably damaging	Het
Pamr1	T	A	2: 102,642,300	F648Y	probably damaging	Het
Parg	T	C	14: 32,210,540	W446R	probably damaging	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Phf7	T	C	14: 31,240,324	I175V	possibly damaging	Het
Pibf1	G	A	14: 99,187,809		probably null	Het
Plcxd1	A	G	5: 110,103,442	I295V	probably benign	Het
Pole2	A	C	12: 69,209,990	Y254D	probably damaging	Het
Ppm1e	T	A	11: 87,244,370	I225F	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnase2b	T	G	14: 51,162,900	V146G	probably damaging	Het
Rnf169	G	A	7: 99,926,254	T378I	probably damaging	Het
Rpf2	A	G	10: 40,236,201	F80L	probably benign	Het
Sec11c	T	A	18: 65,814,874	D128E	probably damaging	Het
Sept12	A	G	16: 4,988,553	V248A	probably damaging	Het
Serinc1	T	C	10: 57,525,451	N82S	probably benign	Het
Serpina9	A	C	12: 104,001,249	W296G	probably damaging	Het
Sgo2b	A	C	8: 63,931,469	D164E	probably damaging	Het
Slc15a3	A	G	19: 10,848,613	N223D	probably damaging	Het
Slc44a3	A	G	3: 121,532,166	Y12H	probably benign	Het
Slco3a1	A	G	7: 74,504,611	F42S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Sorl1	A	T	9: 42,081,950	D259E	probably damaging	Het
Stpg2	G	A	3: 139,522,981		probably null	Het
Strn	T	A	17: 78,684,395	Y165F	probably damaging	Het
Sval2	T	A	6: 41,864,320	*106R	probably null	Het
Tcaf3	A	G	6: 42,596,688	S197P	possibly damaging	Het
Tespa1	C	A	10: 130,354,723	T73N	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Thoc5	C	A	11: 4,915,561	T380K	probably benign	Het
Tmprss7	T	A	16: 45,656,548	R784*	probably null	Het
Trank1	A	T	9: 111,390,709	L2171F	probably benign	Het
Trpm2	T	G	10: 77,945,876	K303T	probably benign	Het
Tsta3	A	T	15: 75,925,649	D278E	possibly damaging	Het
Unc80	G	A	1: 66,510,625	V681M	probably damaging	Het
Usp40	A	G	1: 87,946,646	F1131L	probably benign	Het
Vmn1r215	A	T	13: 23,076,503	I238F	possibly damaging	Het
Vwa3a	A	T	7: 120,795,627	Y890F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,860	L234P	probably damaging	Het
Zfp109	A	G	7: 24,228,251	S578P	probably damaging	Het
Zfp704	T	C	3: 9,609,358	D121G	unknown	Het
Zgrf1	G	T	3: 127,563,137	V671L	probably benign	Het
Zkscan8	A	T	13: 21,520,757	C265*	probably null	Het
Zscan26	T	C	13: 21,445,140	I398V	possibly damaging	Het

Other mutations in Asph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Asph	APN	4	9639322	missense	probably damaging	1.00
IGL00928:Asph	APN	4	9594675	missense	probably benign	0.07
IGL01022:Asph	APN	4	9601344	missense	possibly damaging	0.63
IGL01677:Asph	APN	4	9607853	missense	probably damaging	1.00
IGL01907:Asph	APN	4	9514643	missense	possibly damaging	0.59
IGL01958:Asph	APN	4	9474904	missense	possibly damaging	0.93
IGL01976:Asph	APN	4	9475471	missense	probably damaging	0.98
IGL01989:Asph	APN	4	9602462	splice site	probably benign
IGL02379:Asph	APN	4	9474980	missense	probably damaging	1.00
IGL02444:Asph	APN	4	9542319	splice site	probably benign
IGL02652:Asph	APN	4	9529984	missense	probably benign	0.11
IGL02679:Asph	APN	4	9601349	missense	possibly damaging	0.63
IGL02735:Asph	APN	4	9598759	missense	probably damaging	1.00
IGL02875:Asph	APN	4	9595380	missense	probably damaging	1.00
IGL03022:Asph	APN	4	9517668	missense	possibly damaging	0.48
R0026:Asph	UTSW	4	9601361	missense	probably damaging	0.97
R0121:Asph	UTSW	4	9635918	missense	probably damaging	1.00
R0357:Asph	UTSW	4	9453314	missense	probably benign	0.01
R0410:Asph	UTSW	4	9595415	missense	probably damaging	1.00
R0554:Asph	UTSW	4	9604581	missense	probably damaging	0.99
R0577:Asph	UTSW	4	9604620	missense	probably benign	0.02
R0718:Asph	UTSW	4	9514683	splice site	probably benign
R0725:Asph	UTSW	4	9542275	missense	probably damaging	1.00
R1383:Asph	UTSW	4	9537807	splice site	probably null
R1654:Asph	UTSW	4	9453315	missense	probably benign	0.31
R1694:Asph	UTSW	4	9610869	missense	probably damaging	0.99
R1771:Asph	UTSW	4	9598773	missense	probably damaging	0.99
R1776:Asph	UTSW	4	9598773	missense	probably damaging	0.99
R1840:Asph	UTSW	4	9601340	missense	possibly damaging	0.60
R1911:Asph	UTSW	4	9453335	missense	probably damaging	1.00
R2117:Asph	UTSW	4	9517671	nonsense	probably null
R2860:Asph	UTSW	4	9598277	missense	probably damaging	1.00
R2861:Asph	UTSW	4	9598277	missense	probably damaging	1.00
R2937:Asph	UTSW	4	9542314	splice site	probably benign
R3907:Asph	UTSW	4	9474934	missense	probably benign	0.23
R4154:Asph	UTSW	4	9639250	nonsense	probably null
R4623:Asph	UTSW	4	9622005	missense	possibly damaging	0.50
R4871:Asph	UTSW	4	9531968	missense	probably benign	0.02
R5196:Asph	UTSW	4	9607830	missense	probably damaging	0.99
R5540:Asph	UTSW	4	9635906	missense	probably damaging	1.00
R5757:Asph	UTSW	4	9637722	splice site	probably null
R6063:Asph	UTSW	4	9531960	missense	probably benign	0.05
R6072:Asph	UTSW	4	9643533	critical splice donor site	probably null
R7016:Asph	UTSW	4	9630604	splice site	probably null
R7133:Asph	UTSW	4	9484575	missense	probably benign	0.01
R7154:Asph	UTSW	4	9630930	missense	possibly damaging	0.85
R7201:Asph	UTSW	4	9474917	missense	probably damaging	1.00
R7316:Asph	UTSW	4	9537746	missense	probably benign	0.11
R7455:Asph	UTSW	4	9531732	splice site	probably null
R7516:Asph	UTSW	4	9630940	missense	possibly damaging	0.92
R7517:Asph	UTSW	4	9517697	missense	probably damaging	1.00
R7736:Asph	UTSW	4	9621930	missense	possibly damaging	0.81
R7818:Asph	UTSW	4	9475015	missense	probably damaging	1.00
R8356:Asph	UTSW	4	9537722	missense	probably benign	0.04
R8456:Asph	UTSW	4	9537722	missense	probably benign	0.04
R8768:Asph	UTSW	4	9453417	missense	probably damaging	1.00
R8856:Asph	UTSW	4	9630947	missense	possibly damaging	0.71
R9024:Asph	UTSW	4	9475025	missense	probably damaging	1.00
R9125:Asph	UTSW	4	9474928	missense	possibly damaging	0.58
R9390:Asph	UTSW	4	9635927	missense	probably damaging	1.00
R9708:Asph	UTSW	4	9542233	missense	probably damaging	1.00
Z1088:Asph	UTSW	4	9630715	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCAGGAAGGCAAATGTTCCC -3'
(R):5'- GTCCATGGACAGAAACTGGTCC -3'

Sequencing Primer
(F):5'- CTCCAGTGAGTTCTAATCCAGAAGG -3'
(R):5'- GACAGAAACTGGTCCTCGAGC -3'

Posted On

2014-06-30