Mutagenetix > Incidental Mutation

Incidental Mutation 'R1912:Cfap57'

210368

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

039930-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1912 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 118615010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 57 (S57R)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably damaging
Transcript: ENSMUST00000071972
AA Change: S57R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: S57R

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081921
AA Change: S57R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: S57R

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
2810474O19Rik	T	A	6: 149,328,844	D1129E	possibly damaging	Het
2900092C05Rik	A	G	7: 12,554,655	M132V	probably benign	Het
4921524L21Rik	T	A	18: 6,620,205	I45N	possibly damaging	Het
9230113P08Rik	A	T	9: 35,908,619	T23S	probably benign	Het
Abcb6	A	G	1: 75,179,955	V55A	probably benign	Het
Adam28	A	T	14: 68,644,331	D105E	probably benign	Het
Ahnak	T	C	19: 9,017,881	S5510P	probably damaging	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Alx1	A	G	10: 103,025,361	L102P	probably damaging	Het
Ankrd50	C	T	3: 38,456,776	V481I	probably benign	Het
Aox4	G	T	1: 58,264,402	G1200W	probably damaging	Het
Arhgap45	A	C	10: 80,020,690	D24A	probably benign	Het
Arhgef16	A	T	4: 154,280,323		probably null	Het
Asic4	A	T	1: 75,469,232	Y235F	possibly damaging	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Atg4d	A	G	9: 21,272,639	D350G	probably damaging	Het
Auts2	T	C	5: 131,443,574	T347A	probably damaging	Het
Bsnd	A	T	4: 106,488,030	L73*	probably null	Het
Cachd1	A	T	4: 100,953,169	S323C	probably damaging	Het
Cacna1e	A	G	1: 154,436,449	I1290T	probably damaging	Het
Cdh8	T	A	8: 99,098,870	N498Y	probably damaging	Het
Cdkn3	A	G	14: 46,769,834		probably null	Het
Celf2	A	T	2: 6,615,753	M40K	probably damaging	Het
Cfh	A	G	1: 140,136,141		probably null	Het
Chdh	A	G	14: 30,032,788	S252G	probably benign	Het
Col8a1	T	A	16: 57,627,924	I408F	unknown	Het
Corin	C	T	5: 72,358,403	C303Y	probably damaging	Het
Crlf2	C	T	5: 109,557,141	C66Y	possibly damaging	Het
Csmd1	C	T	8: 16,233,998		probably null	Het
Cyp4f16	T	C	17: 32,545,044	V270A	probably damaging	Het
Defa29	T	A	8: 21,326,012	H113L	possibly damaging	Het
Dhx35	A	T	2: 158,842,307	N501Y	probably damaging	Het
Dst	A	G	1: 34,291,850	R4690G	probably damaging	Het
Elac2	T	A	11: 64,994,263	D439E	probably benign	Het
Ercc6	A	G	14: 32,576,803	R1383G	probably damaging	Het
Fam69b	A	G	2: 26,632,704	E55G	probably damaging	Het
Fat3	T	A	9: 15,969,988	Y3196F	probably damaging	Het
Fbxw13	A	T	9: 109,181,543	D342E	probably benign	Het
Fmod	A	G	1: 134,040,720	N166S	possibly damaging	Het
Folh1	A	G	7: 86,762,967	S199P	possibly damaging	Het
Fv1	A	G	4: 147,869,778	N267S	possibly damaging	Het
Fyn	T	C	10: 39,526,832	V200A	possibly damaging	Het
Ggnbp2	T	C	11: 84,862,296	N39S	probably benign	Het
Gm10509	A	T	17: 21,690,924	I53F	possibly damaging	Het
Gpr139	A	T	7: 119,144,879	I161N	possibly damaging	Het
Grhl2	C	T	15: 37,358,407	T148I	probably damaging	Het
Hmcn1	C	A	1: 150,604,882	M4514I	probably benign	Het
Igsf10	T	G	3: 59,329,572	T1063P	probably benign	Het
Itgav	A	G	2: 83,795,486	Y792C	possibly damaging	Het
Itgb2l	T	C	16: 96,426,935	Q456R	probably benign	Het
Jph4	G	A	14: 55,108,361	A613V	probably benign	Het
Kcna2	A	G	3: 107,105,401	T433A	probably benign	Het
Kmt2e	A	G	5: 23,492,395	K97R	probably benign	Het
Krba1	C	A	6: 48,415,765	A871E	probably benign	Het
Loxhd1	T	C	18: 77,340,137	F468L	probably benign	Het
Lpin1	A	G	12: 16,546,727	V713A	probably damaging	Het
Ltbp2	T	A	12: 84,785,863	I67F	probably damaging	Het
Mdc1	G	A	17: 35,844,538	R35H	probably benign	Het
Mdc1	A	G	17: 35,850,811	D872G	probably benign	Het
Mgam	C	T	6: 40,764,185	Q959*	probably null	Het
Mttp	T	A	3: 138,116,027	T260S	probably benign	Het
Naalad2	A	T	9: 18,376,535	D266E	probably benign	Het
Nans	T	A	4: 46,500,162	L182H	probably damaging	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nfix	A	T	8: 84,721,677	V407E	probably damaging	Het
Nktr	T	A	9: 121,750,240		probably benign	Het
Nlrp10	G	A	7: 108,925,395	R293*	probably null	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1126	T	C	2: 87,457,383	S73P	probably damaging	Het
Olfr212	A	G	6: 116,515,989	T71A	probably benign	Het
Olfr380	A	T	11: 73,453,994	F73I	probably damaging	Het
Olfr402	T	C	11: 74,155,885	C244R	probably damaging	Het
Olfr452	T	C	6: 42,790,477	I146T	probably benign	Het
Olfr493	A	G	7: 108,346,807	L58P	probably damaging	Het
Olfr749	G	A	14: 50,736,778	P128L	probably damaging	Het
Olfr994	T	A	2: 85,430,260	N190Y	probably damaging	Het
Oxld1	A	G	11: 120,456,906	V155A	probably damaging	Het
Pamr1	T	A	2: 102,642,300	F648Y	probably damaging	Het
Parg	T	C	14: 32,210,540	W446R	probably damaging	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Phf7	T	C	14: 31,240,324	I175V	possibly damaging	Het
Pibf1	G	A	14: 99,187,809		probably null	Het
Plcxd1	A	G	5: 110,103,442	I295V	probably benign	Het
Pole2	A	C	12: 69,209,990	Y254D	probably damaging	Het
Ppm1e	T	A	11: 87,244,370	I225F	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnase2b	T	G	14: 51,162,900	V146G	probably damaging	Het
Rnf169	G	A	7: 99,926,254	T378I	probably damaging	Het
Rpf2	A	G	10: 40,236,201	F80L	probably benign	Het
Sec11c	T	A	18: 65,814,874	D128E	probably damaging	Het
Sept12	A	G	16: 4,988,553	V248A	probably damaging	Het
Serinc1	T	C	10: 57,525,451	N82S	probably benign	Het
Serpina9	A	C	12: 104,001,249	W296G	probably damaging	Het
Sgo2b	A	C	8: 63,931,469	D164E	probably damaging	Het
Slc15a3	A	G	19: 10,848,613	N223D	probably damaging	Het
Slc44a3	A	G	3: 121,532,166	Y12H	probably benign	Het
Slco3a1	A	G	7: 74,504,611	F42S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Sorl1	A	T	9: 42,081,950	D259E	probably damaging	Het
Stpg2	G	A	3: 139,522,981		probably null	Het
Strn	T	A	17: 78,684,395	Y165F	probably damaging	Het
Sval2	T	A	6: 41,864,320	*106R	probably null	Het
Tcaf3	A	G	6: 42,596,688	S197P	possibly damaging	Het
Tespa1	C	A	10: 130,354,723	T73N	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Thoc5	C	A	11: 4,915,561	T380K	probably benign	Het
Tmprss7	T	A	16: 45,656,548	R784*	probably null	Het
Trank1	A	T	9: 111,390,709	L2171F	probably benign	Het
Trpm2	T	G	10: 77,945,876	K303T	probably benign	Het
Tsta3	A	T	15: 75,925,649	D278E	possibly damaging	Het
Unc80	G	A	1: 66,510,625	V681M	probably damaging	Het
Usp40	A	G	1: 87,946,646	F1131L	probably benign	Het
Vmn1r215	A	T	13: 23,076,503	I238F	possibly damaging	Het
Vwa3a	A	T	7: 120,795,627	Y890F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,860	L234P	probably damaging	Het
Zfp109	A	G	7: 24,228,251	S578P	probably damaging	Het
Zfp704	T	C	3: 9,609,358	D121G	unknown	Het
Zgrf1	G	T	3: 127,563,137	V671L	probably benign	Het
Zkscan8	A	T	13: 21,520,757	C265*	probably null	Het
Zscan26	T	C	13: 21,445,140	I398V	possibly damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTCAGCAGGTATTTAGAGTCTGGAG -3'
(R):5'- AGCTCAACCTAGTGAGCTGC -3'

Sequencing Primer
(F):5'- GAAAAAGCCATGCTGGTAAACTTTTG -3'
(R):5'- ACCTAGTGAGCTGCCCACC -3'

Posted On

2014-06-30