Incidental Mutation 'R0121:Olfr937'
ID21041
Institutional Source Beutler Lab
Gene Symbol Olfr937
Ensembl Gene ENSMUSG00000094182
Gene Nameolfactory receptor 937
SynonymsMOR171-24, GA_x6K02T2PVTD-32756567-32755632
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location39058851-39064951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39059760 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 302 (K302M)
Ref Sequence ENSEMBL: ENSMUSP00000150274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055567] [ENSMUST00000215049]
Predicted Effect probably damaging
Transcript: ENSMUST00000055567
AA Change: K302M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058346
Gene: ENSMUSG00000094182
AA Change: K302M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 1.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215049
AA Change: K302M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Olfr937
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr937 APN 9 39059863 missense probably benign 0.03
IGL01387:Olfr937 APN 9 39060321 missense probably damaging 1.00
IGL01775:Olfr937 APN 9 39060467 missense probably damaging 1.00
IGL02076:Olfr937 APN 9 39060585 missense probably damaging 1.00
IGL02740:Olfr937 APN 9 39060289 missense probably benign 0.22
IGL03115:Olfr937 APN 9 39059963 missense probably damaging 0.99
R0908:Olfr937 UTSW 9 39059947 missense probably damaging 1.00
R1559:Olfr937 UTSW 9 39060141 missense probably benign 0.20
R2006:Olfr937 UTSW 9 39060433 missense probably damaging 0.99
R2010:Olfr937 UTSW 9 39060099 missense probably benign 0.05
R2191:Olfr937 UTSW 9 39060405 missense probably benign
R3874:Olfr937 UTSW 9 39060174 missense probably benign 0.00
R4970:Olfr937 UTSW 9 39060531 missense probably benign 0.12
R5217:Olfr937 UTSW 9 39059769 missense probably benign 0.00
R5836:Olfr937 UTSW 9 39060622 missense probably benign
R5886:Olfr937 UTSW 9 39060382 missense probably benign 0.00
R6109:Olfr937 UTSW 9 39060196 missense probably benign 0.23
R7261:Olfr937 UTSW 9 39060208 missense possibly damaging 0.64
R7328:Olfr937 UTSW 9 39060561 missense probably damaging 1.00
R7345:Olfr937 UTSW 9 39060579 missense probably damaging 1.00
R7419:Olfr937 UTSW 9 39060169 missense probably benign 0.00
X0022:Olfr937 UTSW 9 39060417 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTGGAGTTTTCCAGGTGGTTTCCAA -3'
(R):5'- TGGGTCTGCTGCATTCATGTACCTTCAA -3'

Sequencing Primer
(F):5'- TAATGTAAAGTTGATGGGACTGACTG -3'
(R):5'- TGTACCTTCAACCATCATCAGTCAG -3'
Posted On2013-04-11