Incidental Mutation 'R1912:Sorl1'
ID 210411
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms Sorla, mSorLA, LR11, 2900010L19Rik
MMRRC Submission 039930-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R1912 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 41876016-42035593 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41993246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 259 (D259E)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: D259E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: D259E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,288,582 (GRCm39) M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 (GRCm39) I45N possibly damaging Het
Abcb6 A G 1: 75,156,599 (GRCm39) V55A probably benign Het
Adam28 A T 14: 68,881,780 (GRCm39) D105E probably benign Het
Ahnak T C 19: 8,995,245 (GRCm39) S5510P probably damaging Het
Aldh3b1 T G 19: 3,971,187 (GRCm39) D159A probably damaging Het
Alx1 A G 10: 102,861,222 (GRCm39) L102P probably damaging Het
Ankrd50 C T 3: 38,510,925 (GRCm39) V481I probably benign Het
Aox4 G T 1: 58,303,561 (GRCm39) G1200W probably damaging Het
Arhgap45 A C 10: 79,856,524 (GRCm39) D24A probably benign Het
Arhgef16 A T 4: 154,364,780 (GRCm39) probably null Het
Asic4 A T 1: 75,445,876 (GRCm39) Y235F possibly damaging Het
Asph T C 4: 9,453,335 (GRCm39) E646G probably damaging Het
Atg4d A G 9: 21,183,935 (GRCm39) D350G probably damaging Het
Auts2 T C 5: 131,472,412 (GRCm39) T347A probably damaging Het
Bsnd A T 4: 106,345,227 (GRCm39) L73* probably null Het
Cachd1 A T 4: 100,810,366 (GRCm39) S323C probably damaging Het
Cacna1e A G 1: 154,312,195 (GRCm39) I1290T probably damaging Het
Cdh8 T A 8: 99,825,502 (GRCm39) N498Y probably damaging Het
Cdkn3 A G 14: 47,007,291 (GRCm39) probably null Het
Celf2 A T 2: 6,620,564 (GRCm39) M40K probably damaging Het
Cfap57 A C 4: 118,472,207 (GRCm39) S57R probably damaging Het
Cfh A G 1: 140,063,879 (GRCm39) probably null Het
Chdh A G 14: 29,754,745 (GRCm39) S252G probably benign Het
Col8a1 T A 16: 57,448,287 (GRCm39) I408F unknown Het
Corin C T 5: 72,515,746 (GRCm39) C303Y probably damaging Het
Crlf2 C T 5: 109,705,007 (GRCm39) C66Y possibly damaging Het
Csmd1 C T 8: 16,284,012 (GRCm39) probably null Het
Cyp4f16 T C 17: 32,764,018 (GRCm39) V270A probably damaging Het
Defa29 T A 8: 21,816,028 (GRCm39) H113L possibly damaging Het
Dhx35 A T 2: 158,684,227 (GRCm39) N501Y probably damaging Het
Dipk1b A G 2: 26,522,716 (GRCm39) E55G probably damaging Het
Dst A G 1: 34,330,931 (GRCm39) R4690G probably damaging Het
Elac2 T A 11: 64,885,089 (GRCm39) D439E probably benign Het
Ercc6 A G 14: 32,298,760 (GRCm39) R1383G probably damaging Het
Fat3 T A 9: 15,881,284 (GRCm39) Y3196F probably damaging Het
Fbxw13 A T 9: 109,010,611 (GRCm39) D342E probably benign Het
Fmod A G 1: 133,968,458 (GRCm39) N166S possibly damaging Het
Folh1 A G 7: 86,412,175 (GRCm39) S199P possibly damaging Het
Fv1 A G 4: 147,954,235 (GRCm39) N267S possibly damaging Het
Fyn T C 10: 39,402,828 (GRCm39) V200A possibly damaging Het
Gfus A T 15: 75,797,498 (GRCm39) D278E possibly damaging Het
Ggnbp2 T C 11: 84,753,122 (GRCm39) N39S probably benign Het
Gm10509 A T 17: 21,909,831 (GRCm39) I53F possibly damaging Het
Gpr139 A T 7: 118,744,102 (GRCm39) I161N possibly damaging Het
Grhl2 C T 15: 37,358,651 (GRCm39) T148I probably damaging Het
Hmcn1 C A 1: 150,480,633 (GRCm39) M4514I probably benign Het
Igsf10 T G 3: 59,236,993 (GRCm39) T1063P probably benign Het
Itgav A G 2: 83,625,830 (GRCm39) Y792C possibly damaging Het
Itgb2l T C 16: 96,228,135 (GRCm39) Q456R probably benign Het
Jph4 G A 14: 55,345,818 (GRCm39) A613V probably benign Het
Kcna2 A G 3: 107,012,717 (GRCm39) T433A probably benign Het
Kmt2e A G 5: 23,697,393 (GRCm39) K97R probably benign Het
Krba1 C A 6: 48,392,699 (GRCm39) A871E probably benign Het
Loxhd1 T C 18: 77,427,833 (GRCm39) F468L probably benign Het
Lpin1 A G 12: 16,596,728 (GRCm39) V713A probably damaging Het
Ltbp2 T A 12: 84,832,637 (GRCm39) I67F probably damaging Het
Mdc1 G A 17: 36,155,430 (GRCm39) R35H probably benign Het
Mdc1 A G 17: 36,161,703 (GRCm39) D872G probably benign Het
Mgam C T 6: 40,741,119 (GRCm39) Q959* probably null Het
Mttp T A 3: 137,821,788 (GRCm39) T260S probably benign Het
Naalad2 A T 9: 18,287,831 (GRCm39) D266E probably benign Het
Nans T A 4: 46,500,162 (GRCm39) L182H probably damaging Het
Nbas T A 12: 13,616,145 (GRCm39) C2228S probably benign Het
Nfix A T 8: 85,448,306 (GRCm39) V407E probably damaging Het
Nktr T A 9: 121,579,306 (GRCm39) probably benign Het
Nlrp10 G A 7: 108,524,602 (GRCm39) R293* probably null Het
Nrxn3 T C 12: 88,762,112 (GRCm39) F53S probably damaging Het
Or11h4 G A 14: 50,974,235 (GRCm39) P128L probably damaging Het
Or12e7 T C 2: 87,287,727 (GRCm39) S73P probably damaging Het
Or1e21 A T 11: 73,344,820 (GRCm39) F73I probably damaging Het
Or2f2 T C 6: 42,767,411 (GRCm39) I146T probably benign Het
Or3a1c T C 11: 74,046,711 (GRCm39) C244R probably damaging Het
Or5ak24 T A 2: 85,260,604 (GRCm39) N190Y probably damaging Het
Or5p68 A G 7: 107,946,014 (GRCm39) L58P probably damaging Het
Or6d12 A G 6: 116,492,950 (GRCm39) T71A probably benign Het
Oxld1 A G 11: 120,347,732 (GRCm39) V155A probably damaging Het
Pamr1 T A 2: 102,472,645 (GRCm39) F648Y probably damaging Het
Parg T C 14: 31,932,497 (GRCm39) W446R probably damaging Het
Pate13 A T 9: 35,819,915 (GRCm39) T23S probably benign Het
Phf3 A T 1: 30,843,426 (GRCm39) H1844Q probably damaging Het
Phf7 T C 14: 30,962,281 (GRCm39) I175V possibly damaging Het
Pibf1 G A 14: 99,425,245 (GRCm39) probably null Het
Plcxd1 A G 5: 110,251,308 (GRCm39) I295V probably benign Het
Pole2 A C 12: 69,256,764 (GRCm39) Y254D probably damaging Het
Ppm1e T A 11: 87,135,196 (GRCm39) I225F probably benign Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Resf1 T A 6: 149,230,342 (GRCm39) D1129E possibly damaging Het
Rnase2b T G 14: 51,400,357 (GRCm39) V146G probably damaging Het
Rnf169 G A 7: 99,575,461 (GRCm39) T378I probably damaging Het
Rpf2 A G 10: 40,112,197 (GRCm39) F80L probably benign Het
Sec11c T A 18: 65,947,945 (GRCm39) D128E probably damaging Het
Septin12 A G 16: 4,806,417 (GRCm39) V248A probably damaging Het
Serinc1 T C 10: 57,401,547 (GRCm39) N82S probably benign Het
Serpina9 A C 12: 103,967,508 (GRCm39) W296G probably damaging Het
Sgo2b A C 8: 64,384,503 (GRCm39) D164E probably damaging Het
Slc15a3 A G 19: 10,825,977 (GRCm39) N223D probably damaging Het
Slc44a3 A G 3: 121,325,815 (GRCm39) Y12H probably benign Het
Slco3a1 A G 7: 74,154,359 (GRCm39) F42S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx7 A T 3: 117,623,317 (GRCm39) probably null Het
Stpg2 G A 3: 139,228,742 (GRCm39) probably null Het
Strn T A 17: 78,991,824 (GRCm39) Y165F probably damaging Het
Sval2 T A 6: 41,841,254 (GRCm39) *106R probably null Het
Tcaf3 A G 6: 42,573,622 (GRCm39) S197P possibly damaging Het
Tespa1 C A 10: 130,190,592 (GRCm39) T73N probably benign Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Thoc5 C A 11: 4,865,561 (GRCm39) T380K probably benign Het
Tmprss7 T A 16: 45,476,911 (GRCm39) R784* probably null Het
Trank1 A T 9: 111,219,777 (GRCm39) L2171F probably benign Het
Trpm2 T G 10: 77,781,710 (GRCm39) K303T probably benign Het
Unc80 G A 1: 66,549,784 (GRCm39) V681M probably damaging Het
Usp40 A G 1: 87,874,368 (GRCm39) F1131L probably benign Het
Vmn1r215 A T 13: 23,260,673 (GRCm39) I238F possibly damaging Het
Vwa3a A T 7: 120,394,850 (GRCm39) Y890F probably damaging Het
Zdhhc18 A G 4: 133,341,171 (GRCm39) L234P probably damaging Het
Zfp109 A G 7: 23,927,676 (GRCm39) S578P probably damaging Het
Zfp704 T C 3: 9,674,418 (GRCm39) D121G unknown Het
Zgrf1 G T 3: 127,356,786 (GRCm39) V671L probably benign Het
Zkscan8 A T 13: 21,704,927 (GRCm39) C265* probably null Het
Zscan26 T C 13: 21,629,310 (GRCm39) I398V possibly damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41,885,390 (GRCm39) missense probably damaging 1.00
IGL01303:Sorl1 APN 9 41,935,774 (GRCm39) splice site probably benign
IGL01545:Sorl1 APN 9 41,955,252 (GRCm39) missense probably damaging 1.00
IGL01629:Sorl1 APN 9 41,968,565 (GRCm39) critical splice donor site probably null
IGL01670:Sorl1 APN 9 41,912,788 (GRCm39) missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41,892,007 (GRCm39) missense probably damaging 0.96
IGL02154:Sorl1 APN 9 41,915,330 (GRCm39) missense probably benign
IGL02215:Sorl1 APN 9 41,929,478 (GRCm39) missense probably damaging 0.97
IGL02427:Sorl1 APN 9 41,952,986 (GRCm39) missense probably damaging 1.00
IGL02590:Sorl1 APN 9 41,957,857 (GRCm39) missense probably benign 0.01
IGL02794:Sorl1 APN 9 41,975,070 (GRCm39) missense probably damaging 0.98
IGL02797:Sorl1 APN 9 41,948,355 (GRCm39) missense probably damaging 0.99
IGL02987:Sorl1 APN 9 41,952,349 (GRCm39) missense probably damaging 1.00
IGL03005:Sorl1 APN 9 41,968,621 (GRCm39) missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41,902,722 (GRCm39) missense probably benign
IGL03288:Sorl1 APN 9 41,944,858 (GRCm39) splice site probably benign
N/A - 287:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
PIT4151001:Sorl1 UTSW 9 41,879,918 (GRCm39) missense probably damaging 1.00
R0117:Sorl1 UTSW 9 41,944,873 (GRCm39) missense probably benign 0.10
R0173:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R0318:Sorl1 UTSW 9 41,993,250 (GRCm39) missense probably damaging 1.00
R0385:Sorl1 UTSW 9 41,943,205 (GRCm39) missense probably damaging 0.99
R0448:Sorl1 UTSW 9 41,915,384 (GRCm39) missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41,902,667 (GRCm39) missense probably null 0.00
R0512:Sorl1 UTSW 9 41,979,128 (GRCm39) missense probably benign 0.01
R0587:Sorl1 UTSW 9 41,895,802 (GRCm39) missense probably damaging 1.00
R0600:Sorl1 UTSW 9 41,955,196 (GRCm39) splice site probably benign
R0831:Sorl1 UTSW 9 41,982,365 (GRCm39) splice site probably benign
R0924:Sorl1 UTSW 9 41,919,470 (GRCm39) splice site probably benign
R1013:Sorl1 UTSW 9 41,913,855 (GRCm39) missense probably benign 0.00
R1053:Sorl1 UTSW 9 41,902,752 (GRCm39) missense probably benign
R1077:Sorl1 UTSW 9 41,925,786 (GRCm39) missense probably damaging 1.00
R1326:Sorl1 UTSW 9 41,943,092 (GRCm39) missense probably benign 0.14
R1348:Sorl1 UTSW 9 41,911,708 (GRCm39) splice site probably null
R1498:Sorl1 UTSW 9 41,952,369 (GRCm39) missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41,885,296 (GRCm39) missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41,907,538 (GRCm39) missense probably benign 0.06
R1738:Sorl1 UTSW 9 42,001,261 (GRCm39) missense probably benign 0.33
R1779:Sorl1 UTSW 9 41,902,778 (GRCm39) critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41,881,021 (GRCm39) nonsense probably null
R1952:Sorl1 UTSW 9 41,957,920 (GRCm39) missense probably benign
R2071:Sorl1 UTSW 9 41,890,753 (GRCm39) missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41,895,788 (GRCm39) missense probably benign 0.01
R2417:Sorl1 UTSW 9 41,892,007 (GRCm39) missense probably damaging 0.96
R2429:Sorl1 UTSW 9 41,948,366 (GRCm39) missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41,881,077 (GRCm39) missense probably benign
R3815:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 41,915,401 (GRCm39) missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41,900,764 (GRCm39) critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 41,946,744 (GRCm39) missense probably damaging 0.99
R4410:Sorl1 UTSW 9 41,915,288 (GRCm39) nonsense probably null
R4610:Sorl1 UTSW 9 41,943,210 (GRCm39) missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4666:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41,895,804 (GRCm39) missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41,903,617 (GRCm39) missense probably damaging 1.00
R4874:Sorl1 UTSW 9 41,975,048 (GRCm39) missense probably damaging 0.99
R4898:Sorl1 UTSW 9 41,952,935 (GRCm39) missense probably damaging 1.00
R4922:Sorl1 UTSW 9 41,925,746 (GRCm39) splice site probably null
R4976:Sorl1 UTSW 9 41,894,299 (GRCm39) missense probably benign 0.00
R4984:Sorl1 UTSW 9 41,902,638 (GRCm39) missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R5070:Sorl1 UTSW 9 41,943,114 (GRCm39) missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41,887,673 (GRCm39) missense probably benign 0.01
R5202:Sorl1 UTSW 9 41,944,879 (GRCm39) missense probably benign 0.00
R5265:Sorl1 UTSW 9 42,017,812 (GRCm39) missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 41,942,198 (GRCm39) missense probably benign 0.33
R5368:Sorl1 UTSW 9 41,890,686 (GRCm39) missense probably benign 0.00
R5385:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 41,913,932 (GRCm39) nonsense probably null
R5518:Sorl1 UTSW 9 41,948,508 (GRCm39) missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41,902,921 (GRCm39) missense probably benign 0.08
R5864:Sorl1 UTSW 9 42,003,669 (GRCm39) missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41,894,330 (GRCm39) missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41,881,038 (GRCm39) missense probably benign 0.10
R6484:Sorl1 UTSW 9 41,887,703 (GRCm39) missense probably damaging 1.00
R6505:Sorl1 UTSW 9 41,982,530 (GRCm39) missense probably damaging 1.00
R6591:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6596:Sorl1 UTSW 9 41,912,899 (GRCm39) missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41,891,941 (GRCm39) missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6702:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6703:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42,003,748 (GRCm39) missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42,010,559 (GRCm39) missense probably damaging 1.00
R6852:Sorl1 UTSW 9 41,935,694 (GRCm39) missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 41,933,688 (GRCm39) missense probably benign 0.01
R6925:Sorl1 UTSW 9 41,944,922 (GRCm39) missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41,881,047 (GRCm39) missense probably benign 0.11
R7033:Sorl1 UTSW 9 41,942,279 (GRCm39) missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 41,913,930 (GRCm39) missense probably benign 0.00
R7267:Sorl1 UTSW 9 42,035,375 (GRCm39) missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 41,948,499 (GRCm39) missense probably damaging 0.99
R7272:Sorl1 UTSW 9 41,975,006 (GRCm39) splice site probably null
R7537:Sorl1 UTSW 9 41,891,984 (GRCm39) missense probably benign 0.01
R7615:Sorl1 UTSW 9 41,888,878 (GRCm39) missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42,003,630 (GRCm39) missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41,895,822 (GRCm39) missense probably damaging 1.00
R7763:Sorl1 UTSW 9 41,955,205 (GRCm39) missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42,001,257 (GRCm39) missense probably benign 0.17
R7956:Sorl1 UTSW 9 41,900,655 (GRCm39) missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41,902,697 (GRCm39) missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R8151:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R8219:Sorl1 UTSW 9 41,952,857 (GRCm39) splice site probably null
R8261:Sorl1 UTSW 9 41,925,777 (GRCm39) missense probably damaging 1.00
R8283:Sorl1 UTSW 9 41,942,294 (GRCm39) missense probably damaging 1.00
R8308:Sorl1 UTSW 9 41,929,456 (GRCm39) missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8448:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8524:Sorl1 UTSW 9 41,885,370 (GRCm39) missense probably damaging 1.00
R8869:Sorl1 UTSW 9 41,933,722 (GRCm39) missense probably benign 0.01
R8898:Sorl1 UTSW 9 41,911,567 (GRCm39) missense probably damaging 1.00
R8972:Sorl1 UTSW 9 41,957,848 (GRCm39) missense probably damaging 1.00
R9012:Sorl1 UTSW 9 41,982,491 (GRCm39) missense probably damaging 1.00
R9094:Sorl1 UTSW 9 41,975,050 (GRCm39) missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41,885,420 (GRCm39) nonsense probably null
R9278:Sorl1 UTSW 9 41,957,857 (GRCm39) missense probably benign 0.01
R9288:Sorl1 UTSW 9 41,952,927 (GRCm39) missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41,900,739 (GRCm39) missense probably damaging 1.00
R9330:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 1.00
R9332:Sorl1 UTSW 9 41,912,814 (GRCm39) missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42,035,384 (GRCm39) missense probably benign 0.20
R9528:Sorl1 UTSW 9 41,933,631 (GRCm39) critical splice donor site probably null
R9544:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9563:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9564:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9588:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9634:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R9671:Sorl1 UTSW 9 41,943,077 (GRCm39) missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42,003,766 (GRCm39) missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42,035,244 (GRCm39) missense probably benign 0.03
Z1176:Sorl1 UTSW 9 42,010,499 (GRCm39) missense possibly damaging 0.64
Z1177:Sorl1 UTSW 9 42,017,837 (GRCm39) missense probably benign 0.00
Z1177:Sorl1 UTSW 9 41,902,934 (GRCm39) missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42,035,208 (GRCm39) missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTTACCACCACCTTTGTAGC -3'
(R):5'- GTCTTGGAAACAGCCACAGC -3'

Sequencing Primer
(F):5'- GCAAACATATACTTGTCGCGAAG -3'
(R):5'- AAGTGGCAGATCCCCAATTTCTG -3'
Posted On 2014-06-30