Incidental Mutation 'R1912:Mdc1'
ID 210460
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Name mediator of DNA damage checkpoint 1
Synonyms NFBD1
MMRRC Submission 039930-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R1912 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 36152407-36170562 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36161703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 872 (D872G)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: D872G

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: D872G

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,288,582 (GRCm39) M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 (GRCm39) I45N possibly damaging Het
Abcb6 A G 1: 75,156,599 (GRCm39) V55A probably benign Het
Adam28 A T 14: 68,881,780 (GRCm39) D105E probably benign Het
Ahnak T C 19: 8,995,245 (GRCm39) S5510P probably damaging Het
Aldh3b1 T G 19: 3,971,187 (GRCm39) D159A probably damaging Het
Alx1 A G 10: 102,861,222 (GRCm39) L102P probably damaging Het
Ankrd50 C T 3: 38,510,925 (GRCm39) V481I probably benign Het
Aox4 G T 1: 58,303,561 (GRCm39) G1200W probably damaging Het
Arhgap45 A C 10: 79,856,524 (GRCm39) D24A probably benign Het
Arhgef16 A T 4: 154,364,780 (GRCm39) probably null Het
Asic4 A T 1: 75,445,876 (GRCm39) Y235F possibly damaging Het
Asph T C 4: 9,453,335 (GRCm39) E646G probably damaging Het
Atg4d A G 9: 21,183,935 (GRCm39) D350G probably damaging Het
Auts2 T C 5: 131,472,412 (GRCm39) T347A probably damaging Het
Bsnd A T 4: 106,345,227 (GRCm39) L73* probably null Het
Cachd1 A T 4: 100,810,366 (GRCm39) S323C probably damaging Het
Cacna1e A G 1: 154,312,195 (GRCm39) I1290T probably damaging Het
Cdh8 T A 8: 99,825,502 (GRCm39) N498Y probably damaging Het
Cdkn3 A G 14: 47,007,291 (GRCm39) probably null Het
Celf2 A T 2: 6,620,564 (GRCm39) M40K probably damaging Het
Cfap57 A C 4: 118,472,207 (GRCm39) S57R probably damaging Het
Cfh A G 1: 140,063,879 (GRCm39) probably null Het
Chdh A G 14: 29,754,745 (GRCm39) S252G probably benign Het
Col8a1 T A 16: 57,448,287 (GRCm39) I408F unknown Het
Corin C T 5: 72,515,746 (GRCm39) C303Y probably damaging Het
Crlf2 C T 5: 109,705,007 (GRCm39) C66Y possibly damaging Het
Csmd1 C T 8: 16,284,012 (GRCm39) probably null Het
Cyp4f16 T C 17: 32,764,018 (GRCm39) V270A probably damaging Het
Defa29 T A 8: 21,816,028 (GRCm39) H113L possibly damaging Het
Dhx35 A T 2: 158,684,227 (GRCm39) N501Y probably damaging Het
Dipk1b A G 2: 26,522,716 (GRCm39) E55G probably damaging Het
Dst A G 1: 34,330,931 (GRCm39) R4690G probably damaging Het
Elac2 T A 11: 64,885,089 (GRCm39) D439E probably benign Het
Ercc6 A G 14: 32,298,760 (GRCm39) R1383G probably damaging Het
Fat3 T A 9: 15,881,284 (GRCm39) Y3196F probably damaging Het
Fbxw13 A T 9: 109,010,611 (GRCm39) D342E probably benign Het
Fmod A G 1: 133,968,458 (GRCm39) N166S possibly damaging Het
Folh1 A G 7: 86,412,175 (GRCm39) S199P possibly damaging Het
Fv1 A G 4: 147,954,235 (GRCm39) N267S possibly damaging Het
Fyn T C 10: 39,402,828 (GRCm39) V200A possibly damaging Het
Gfus A T 15: 75,797,498 (GRCm39) D278E possibly damaging Het
Ggnbp2 T C 11: 84,753,122 (GRCm39) N39S probably benign Het
Gm10509 A T 17: 21,909,831 (GRCm39) I53F possibly damaging Het
Gpr139 A T 7: 118,744,102 (GRCm39) I161N possibly damaging Het
Grhl2 C T 15: 37,358,651 (GRCm39) T148I probably damaging Het
Hmcn1 C A 1: 150,480,633 (GRCm39) M4514I probably benign Het
Igsf10 T G 3: 59,236,993 (GRCm39) T1063P probably benign Het
Itgav A G 2: 83,625,830 (GRCm39) Y792C possibly damaging Het
Itgb2l T C 16: 96,228,135 (GRCm39) Q456R probably benign Het
Jph4 G A 14: 55,345,818 (GRCm39) A613V probably benign Het
Kcna2 A G 3: 107,012,717 (GRCm39) T433A probably benign Het
Kmt2e A G 5: 23,697,393 (GRCm39) K97R probably benign Het
Krba1 C A 6: 48,392,699 (GRCm39) A871E probably benign Het
Loxhd1 T C 18: 77,427,833 (GRCm39) F468L probably benign Het
Lpin1 A G 12: 16,596,728 (GRCm39) V713A probably damaging Het
Ltbp2 T A 12: 84,832,637 (GRCm39) I67F probably damaging Het
Mgam C T 6: 40,741,119 (GRCm39) Q959* probably null Het
Mttp T A 3: 137,821,788 (GRCm39) T260S probably benign Het
Naalad2 A T 9: 18,287,831 (GRCm39) D266E probably benign Het
Nans T A 4: 46,500,162 (GRCm39) L182H probably damaging Het
Nbas T A 12: 13,616,145 (GRCm39) C2228S probably benign Het
Nfix A T 8: 85,448,306 (GRCm39) V407E probably damaging Het
Nktr T A 9: 121,579,306 (GRCm39) probably benign Het
Nlrp10 G A 7: 108,524,602 (GRCm39) R293* probably null Het
Nrxn3 T C 12: 88,762,112 (GRCm39) F53S probably damaging Het
Or11h4 G A 14: 50,974,235 (GRCm39) P128L probably damaging Het
Or12e7 T C 2: 87,287,727 (GRCm39) S73P probably damaging Het
Or1e21 A T 11: 73,344,820 (GRCm39) F73I probably damaging Het
Or2f2 T C 6: 42,767,411 (GRCm39) I146T probably benign Het
Or3a1c T C 11: 74,046,711 (GRCm39) C244R probably damaging Het
Or5ak24 T A 2: 85,260,604 (GRCm39) N190Y probably damaging Het
Or5p68 A G 7: 107,946,014 (GRCm39) L58P probably damaging Het
Or6d12 A G 6: 116,492,950 (GRCm39) T71A probably benign Het
Oxld1 A G 11: 120,347,732 (GRCm39) V155A probably damaging Het
Pamr1 T A 2: 102,472,645 (GRCm39) F648Y probably damaging Het
Parg T C 14: 31,932,497 (GRCm39) W446R probably damaging Het
Pate13 A T 9: 35,819,915 (GRCm39) T23S probably benign Het
Phf3 A T 1: 30,843,426 (GRCm39) H1844Q probably damaging Het
Phf7 T C 14: 30,962,281 (GRCm39) I175V possibly damaging Het
Pibf1 G A 14: 99,425,245 (GRCm39) probably null Het
Plcxd1 A G 5: 110,251,308 (GRCm39) I295V probably benign Het
Pole2 A C 12: 69,256,764 (GRCm39) Y254D probably damaging Het
Ppm1e T A 11: 87,135,196 (GRCm39) I225F probably benign Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Resf1 T A 6: 149,230,342 (GRCm39) D1129E possibly damaging Het
Rnase2b T G 14: 51,400,357 (GRCm39) V146G probably damaging Het
Rnf169 G A 7: 99,575,461 (GRCm39) T378I probably damaging Het
Rpf2 A G 10: 40,112,197 (GRCm39) F80L probably benign Het
Sec11c T A 18: 65,947,945 (GRCm39) D128E probably damaging Het
Septin12 A G 16: 4,806,417 (GRCm39) V248A probably damaging Het
Serinc1 T C 10: 57,401,547 (GRCm39) N82S probably benign Het
Serpina9 A C 12: 103,967,508 (GRCm39) W296G probably damaging Het
Sgo2b A C 8: 64,384,503 (GRCm39) D164E probably damaging Het
Slc15a3 A G 19: 10,825,977 (GRCm39) N223D probably damaging Het
Slc44a3 A G 3: 121,325,815 (GRCm39) Y12H probably benign Het
Slco3a1 A G 7: 74,154,359 (GRCm39) F42S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx7 A T 3: 117,623,317 (GRCm39) probably null Het
Sorl1 A T 9: 41,993,246 (GRCm39) D259E probably damaging Het
Stpg2 G A 3: 139,228,742 (GRCm39) probably null Het
Strn T A 17: 78,991,824 (GRCm39) Y165F probably damaging Het
Sval2 T A 6: 41,841,254 (GRCm39) *106R probably null Het
Tcaf3 A G 6: 42,573,622 (GRCm39) S197P possibly damaging Het
Tespa1 C A 10: 130,190,592 (GRCm39) T73N probably benign Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Thoc5 C A 11: 4,865,561 (GRCm39) T380K probably benign Het
Tmprss7 T A 16: 45,476,911 (GRCm39) R784* probably null Het
Trank1 A T 9: 111,219,777 (GRCm39) L2171F probably benign Het
Trpm2 T G 10: 77,781,710 (GRCm39) K303T probably benign Het
Unc80 G A 1: 66,549,784 (GRCm39) V681M probably damaging Het
Usp40 A G 1: 87,874,368 (GRCm39) F1131L probably benign Het
Vmn1r215 A T 13: 23,260,673 (GRCm39) I238F possibly damaging Het
Vwa3a A T 7: 120,394,850 (GRCm39) Y890F probably damaging Het
Zdhhc18 A G 4: 133,341,171 (GRCm39) L234P probably damaging Het
Zfp109 A G 7: 23,927,676 (GRCm39) S578P probably damaging Het
Zfp704 T C 3: 9,674,418 (GRCm39) D121G unknown Het
Zgrf1 G T 3: 127,356,786 (GRCm39) V671L probably benign Het
Zkscan8 A T 13: 21,704,927 (GRCm39) C265* probably null Het
Zscan26 T C 13: 21,629,310 (GRCm39) I398V possibly damaging Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 36,158,912 (GRCm39) missense probably benign 0.04
IGL01662:Mdc1 APN 17 36,163,397 (GRCm39) missense probably benign 0.00
IGL01931:Mdc1 APN 17 36,159,123 (GRCm39) missense probably benign 0.00
IGL02542:Mdc1 APN 17 36,164,048 (GRCm39) missense probably damaging 0.96
IGL02823:Mdc1 APN 17 36,163,815 (GRCm39) missense probably damaging 0.99
IGL03411:Mdc1 APN 17 36,164,018 (GRCm39) missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 36,157,083 (GRCm39) missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 36,155,361 (GRCm39) missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 36,159,925 (GRCm39) missense probably benign 0.00
R0129:Mdc1 UTSW 17 36,165,337 (GRCm39) missense probably benign 0.04
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0132:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1597:Mdc1 UTSW 17 36,156,758 (GRCm39) missense probably damaging 1.00
R1721:Mdc1 UTSW 17 36,158,718 (GRCm39) missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1912:Mdc1 UTSW 17 36,155,430 (GRCm39) missense probably benign 0.00
R1977:Mdc1 UTSW 17 36,161,822 (GRCm39) missense probably benign 0.01
R2121:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2122:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2357:Mdc1 UTSW 17 36,158,337 (GRCm39) missense probably benign 0.00
R2842:Mdc1 UTSW 17 36,159,686 (GRCm39) missense probably benign 0.01
R2851:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2852:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2964:Mdc1 UTSW 17 36,164,529 (GRCm39) missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 36,158,785 (GRCm39) unclassified probably benign
R3752:Mdc1 UTSW 17 36,156,821 (GRCm39) missense probably damaging 1.00
R4234:Mdc1 UTSW 17 36,159,716 (GRCm39) missense probably benign 0.00
R4641:Mdc1 UTSW 17 36,168,361 (GRCm39) missense probably benign 0.09
R4706:Mdc1 UTSW 17 36,163,671 (GRCm39) missense probably damaging 0.99
R4809:Mdc1 UTSW 17 36,159,993 (GRCm39) critical splice donor site probably null
R4833:Mdc1 UTSW 17 36,161,286 (GRCm39) missense probably benign 0.20
R5032:Mdc1 UTSW 17 36,161,481 (GRCm39) missense probably benign 0.00
R5047:Mdc1 UTSW 17 36,158,736 (GRCm39) missense probably benign 0.00
R5086:Mdc1 UTSW 17 36,159,522 (GRCm39) missense probably benign 0.00
R5172:Mdc1 UTSW 17 36,163,982 (GRCm39) missense probably benign 0.00
R5254:Mdc1 UTSW 17 36,158,814 (GRCm39) missense probably benign 0.00
R5473:Mdc1 UTSW 17 36,158,952 (GRCm39) missense probably benign 0.01
R5550:Mdc1 UTSW 17 36,156,776 (GRCm39) missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 36,159,438 (GRCm39) missense probably benign 0.00
R5888:Mdc1 UTSW 17 36,158,712 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,168,464 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,159,525 (GRCm39) missense probably benign 0.04
R6219:Mdc1 UTSW 17 36,161,566 (GRCm39) missense probably benign 0.10
R7053:Mdc1 UTSW 17 36,157,218 (GRCm39) missense probably benign 0.00
R7073:Mdc1 UTSW 17 36,164,960 (GRCm39) missense probably benign 0.18
R7077:Mdc1 UTSW 17 36,156,839 (GRCm39) missense probably damaging 0.97
R7424:Mdc1 UTSW 17 36,164,201 (GRCm39) missense probably benign 0.04
R7443:Mdc1 UTSW 17 36,161,712 (GRCm39) missense probably damaging 0.98
R7467:Mdc1 UTSW 17 36,155,448 (GRCm39) missense probably benign 0.29
R7549:Mdc1 UTSW 17 36,159,749 (GRCm39) missense probably null 0.04
R7655:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7656:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7960:Mdc1 UTSW 17 36,161,570 (GRCm39) nonsense probably null
R8350:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8450:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8688:Mdc1 UTSW 17 36,161,383 (GRCm39) missense probably benign 0.10
R8726:Mdc1 UTSW 17 36,158,475 (GRCm39) missense probably benign 0.04
R8919:Mdc1 UTSW 17 36,158,843 (GRCm39) missense probably benign 0.00
R8961:Mdc1 UTSW 17 36,159,407 (GRCm39) missense probably benign 0.10
R9324:Mdc1 UTSW 17 36,164,258 (GRCm39) missense probably benign 0.10
R9363:Mdc1 UTSW 17 36,162,019 (GRCm39) missense probably benign 0.00
R9385:Mdc1 UTSW 17 36,161,396 (GRCm39) missense probably benign 0.00
RF025:Mdc1 UTSW 17 36,165,299 (GRCm39) critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 36,161,829 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGGCAGACAGGATGACCC -3'
(R):5'- AGGACTACATACCCCTTGGC -3'

Sequencing Primer
(F):5'- ACCCCTGAGAGAGAGCCATTG -3'
(R):5'- TCCCAGGGCTCAAAGGGTC -3'
Posted On 2014-06-30