Mutagenetix > Incidental Mutation

Incidental Mutation 'R1912:Loxhd1'

210464

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

039930-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R1912 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77340137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 468 (F468L)

Ref Sequence

ENSEMBL: ENSMUSP00000094294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000148341]

AlphaFold

C8YR32

Predicted Effect

unknown
Transcript: ENSMUST00000035501
AA Change: F235L

SMART Domains

Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818
AA Change: F235L

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	53	3.2e-7	PFAM
LH2	63	176	1.1e-4	SMART
LH2	192	306	4.02e-4	SMART
LH2	320	442	3.79e-6	SMART
LH2	451	567	5.92e-6	SMART
LH2	581	696	7.67e-3	SMART
LH2	793	913	1.47e-11	SMART
low complexity region	922	931	N/A	INTRINSIC
SCOP:d1lox_2	949	974	1e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096547
AA Change: F468L

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: F468L

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000148341
AA Change: F149L

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: F149L

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
2810474O19Rik	T	A	6: 149,328,844	D1129E	possibly damaging	Het
2900092C05Rik	A	G	7: 12,554,655	M132V	probably benign	Het
4921524L21Rik	T	A	18: 6,620,205	I45N	possibly damaging	Het
9230113P08Rik	A	T	9: 35,908,619	T23S	probably benign	Het
Abcb6	A	G	1: 75,179,955	V55A	probably benign	Het
Adam28	A	T	14: 68,644,331	D105E	probably benign	Het
Ahnak	T	C	19: 9,017,881	S5510P	probably damaging	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Alx1	A	G	10: 103,025,361	L102P	probably damaging	Het
Ankrd50	C	T	3: 38,456,776	V481I	probably benign	Het
Aox4	G	T	1: 58,264,402	G1200W	probably damaging	Het
Arhgap45	A	C	10: 80,020,690	D24A	probably benign	Het
Arhgef16	A	T	4: 154,280,323		probably null	Het
Asic4	A	T	1: 75,469,232	Y235F	possibly damaging	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Atg4d	A	G	9: 21,272,639	D350G	probably damaging	Het
Auts2	T	C	5: 131,443,574	T347A	probably damaging	Het
Bsnd	A	T	4: 106,488,030	L73*	probably null	Het
Cachd1	A	T	4: 100,953,169	S323C	probably damaging	Het
Cacna1e	A	G	1: 154,436,449	I1290T	probably damaging	Het
Cdh8	T	A	8: 99,098,870	N498Y	probably damaging	Het
Cdkn3	A	G	14: 46,769,834		probably null	Het
Celf2	A	T	2: 6,615,753	M40K	probably damaging	Het
Cfap57	A	C	4: 118,615,010	S57R	probably damaging	Het
Cfh	A	G	1: 140,136,141		probably null	Het
Chdh	A	G	14: 30,032,788	S252G	probably benign	Het
Col8a1	T	A	16: 57,627,924	I408F	unknown	Het
Corin	C	T	5: 72,358,403	C303Y	probably damaging	Het
Crlf2	C	T	5: 109,557,141	C66Y	possibly damaging	Het
Csmd1	C	T	8: 16,233,998		probably null	Het
Cyp4f16	T	C	17: 32,545,044	V270A	probably damaging	Het
Defa29	T	A	8: 21,326,012	H113L	possibly damaging	Het
Dhx35	A	T	2: 158,842,307	N501Y	probably damaging	Het
Dst	A	G	1: 34,291,850	R4690G	probably damaging	Het
Elac2	T	A	11: 64,994,263	D439E	probably benign	Het
Ercc6	A	G	14: 32,576,803	R1383G	probably damaging	Het
Fam69b	A	G	2: 26,632,704	E55G	probably damaging	Het
Fat3	T	A	9: 15,969,988	Y3196F	probably damaging	Het
Fbxw13	A	T	9: 109,181,543	D342E	probably benign	Het
Fmod	A	G	1: 134,040,720	N166S	possibly damaging	Het
Folh1	A	G	7: 86,762,967	S199P	possibly damaging	Het
Fv1	A	G	4: 147,869,778	N267S	possibly damaging	Het
Fyn	T	C	10: 39,526,832	V200A	possibly damaging	Het
Ggnbp2	T	C	11: 84,862,296	N39S	probably benign	Het
Gm10509	A	T	17: 21,690,924	I53F	possibly damaging	Het
Gpr139	A	T	7: 119,144,879	I161N	possibly damaging	Het
Grhl2	C	T	15: 37,358,407	T148I	probably damaging	Het
Hmcn1	C	A	1: 150,604,882	M4514I	probably benign	Het
Igsf10	T	G	3: 59,329,572	T1063P	probably benign	Het
Itgav	A	G	2: 83,795,486	Y792C	possibly damaging	Het
Itgb2l	T	C	16: 96,426,935	Q456R	probably benign	Het
Jph4	G	A	14: 55,108,361	A613V	probably benign	Het
Kcna2	A	G	3: 107,105,401	T433A	probably benign	Het
Kmt2e	A	G	5: 23,492,395	K97R	probably benign	Het
Krba1	C	A	6: 48,415,765	A871E	probably benign	Het
Lpin1	A	G	12: 16,546,727	V713A	probably damaging	Het
Ltbp2	T	A	12: 84,785,863	I67F	probably damaging	Het
Mdc1	G	A	17: 35,844,538	R35H	probably benign	Het
Mdc1	A	G	17: 35,850,811	D872G	probably benign	Het
Mgam	C	T	6: 40,764,185	Q959*	probably null	Het
Mttp	T	A	3: 138,116,027	T260S	probably benign	Het
Naalad2	A	T	9: 18,376,535	D266E	probably benign	Het
Nans	T	A	4: 46,500,162	L182H	probably damaging	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nfix	A	T	8: 84,721,677	V407E	probably damaging	Het
Nktr	T	A	9: 121,750,240		probably benign	Het
Nlrp10	G	A	7: 108,925,395	R293*	probably null	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1126	T	C	2: 87,457,383	S73P	probably damaging	Het
Olfr212	A	G	6: 116,515,989	T71A	probably benign	Het
Olfr380	A	T	11: 73,453,994	F73I	probably damaging	Het
Olfr402	T	C	11: 74,155,885	C244R	probably damaging	Het
Olfr452	T	C	6: 42,790,477	I146T	probably benign	Het
Olfr493	A	G	7: 108,346,807	L58P	probably damaging	Het
Olfr749	G	A	14: 50,736,778	P128L	probably damaging	Het
Olfr994	T	A	2: 85,430,260	N190Y	probably damaging	Het
Oxld1	A	G	11: 120,456,906	V155A	probably damaging	Het
Pamr1	T	A	2: 102,642,300	F648Y	probably damaging	Het
Parg	T	C	14: 32,210,540	W446R	probably damaging	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Phf7	T	C	14: 31,240,324	I175V	possibly damaging	Het
Pibf1	G	A	14: 99,187,809		probably null	Het
Plcxd1	A	G	5: 110,103,442	I295V	probably benign	Het
Pole2	A	C	12: 69,209,990	Y254D	probably damaging	Het
Ppm1e	T	A	11: 87,244,370	I225F	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnase2b	T	G	14: 51,162,900	V146G	probably damaging	Het
Rnf169	G	A	7: 99,926,254	T378I	probably damaging	Het
Rpf2	A	G	10: 40,236,201	F80L	probably benign	Het
Sec11c	T	A	18: 65,814,874	D128E	probably damaging	Het
Sept12	A	G	16: 4,988,553	V248A	probably damaging	Het
Serinc1	T	C	10: 57,525,451	N82S	probably benign	Het
Serpina9	A	C	12: 104,001,249	W296G	probably damaging	Het
Sgo2b	A	C	8: 63,931,469	D164E	probably damaging	Het
Slc15a3	A	G	19: 10,848,613	N223D	probably damaging	Het
Slc44a3	A	G	3: 121,532,166	Y12H	probably benign	Het
Slco3a1	A	G	7: 74,504,611	F42S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Sorl1	A	T	9: 42,081,950	D259E	probably damaging	Het
Stpg2	G	A	3: 139,522,981		probably null	Het
Strn	T	A	17: 78,684,395	Y165F	probably damaging	Het
Sval2	T	A	6: 41,864,320	*106R	probably null	Het
Tcaf3	A	G	6: 42,596,688	S197P	possibly damaging	Het
Tespa1	C	A	10: 130,354,723	T73N	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Thoc5	C	A	11: 4,915,561	T380K	probably benign	Het
Tmprss7	T	A	16: 45,656,548	R784*	probably null	Het
Trank1	A	T	9: 111,390,709	L2171F	probably benign	Het
Trpm2	T	G	10: 77,945,876	K303T	probably benign	Het
Tsta3	A	T	15: 75,925,649	D278E	possibly damaging	Het
Unc80	G	A	1: 66,510,625	V681M	probably damaging	Het
Usp40	A	G	1: 87,946,646	F1131L	probably benign	Het
Vmn1r215	A	T	13: 23,076,503	I238F	possibly damaging	Het
Vwa3a	A	T	7: 120,795,627	Y890F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,860	L234P	probably damaging	Het
Zfp109	A	G	7: 24,228,251	S578P	probably damaging	Het
Zfp704	T	C	3: 9,609,358	D121G	unknown	Het
Zgrf1	G	T	3: 127,563,137	V671L	probably benign	Het
Zkscan8	A	T	13: 21,520,757	C265*	probably null	Het
Zscan26	T	C	13: 21,445,140	I398V	possibly damaging	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
R9619:Loxhd1	UTSW	18	77356175	missense	probably benign	0.32
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAGTTTACAACGCACCG -3'
(R):5'- TGGACTATTTCAGGTGGAAGATC -3'

Sequencing Primer
(F):5'- GTTTACAACGCACCGTGACCTG -3'
(R):5'- TTTCAGGTGGAAGATCAAACATAAGC -3'

Posted On

2014-06-30