Mutagenetix > Incidental Mutation

Incidental Mutation 'R1912:Ahnak'

210466

Institutional Source

Beutler Lab

Gene Symbol

Ahnak

Ensembl Gene

ENSMUSG00000069833

Gene Name

AHNAK nucleoprotein (desmoyokin)

Synonyms

1110004P15Rik, 2310047C17Rik, DY6

MMRRC Submission

039930-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.491) question?

Stock #

R1912 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8989284-9076919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9017881 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 5510 (S5510P)

Ref Sequence

ENSEMBL: ENSMUSP00000090633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000092955

SMART Domains

Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000092956
AA Change: S5510P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: S5510P

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART
internal_repeat_2	163	1515	5.22e-182	PROSPERO
internal_repeat_1	224	2314	N/A	PROSPERO
internal_repeat_2	1532	3028	5.22e-182	PROSPERO
internal_repeat_1	2660	5095	N/A	PROSPERO
low complexity region	5336	5353	N/A	INTRINSIC
low complexity region	5493	5504	N/A	INTRINSIC
low complexity region	5580	5600	N/A	INTRINSIC
low complexity region	5620	5636	N/A	INTRINSIC

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
2810474O19Rik	T	A	6: 149,328,844	D1129E	possibly damaging	Het
2900092C05Rik	A	G	7: 12,554,655	M132V	probably benign	Het
4921524L21Rik	T	A	18: 6,620,205	I45N	possibly damaging	Het
9230113P08Rik	A	T	9: 35,908,619	T23S	probably benign	Het
Abcb6	A	G	1: 75,179,955	V55A	probably benign	Het
Adam28	A	T	14: 68,644,331	D105E	probably benign	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Alx1	A	G	10: 103,025,361	L102P	probably damaging	Het
Ankrd50	C	T	3: 38,456,776	V481I	probably benign	Het
Aox4	G	T	1: 58,264,402	G1200W	probably damaging	Het
Arhgap45	A	C	10: 80,020,690	D24A	probably benign	Het
Arhgef16	A	T	4: 154,280,323		probably null	Het
Asic4	A	T	1: 75,469,232	Y235F	possibly damaging	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Atg4d	A	G	9: 21,272,639	D350G	probably damaging	Het
Auts2	T	C	5: 131,443,574	T347A	probably damaging	Het
Bsnd	A	T	4: 106,488,030	L73*	probably null	Het
Cachd1	A	T	4: 100,953,169	S323C	probably damaging	Het
Cacna1e	A	G	1: 154,436,449	I1290T	probably damaging	Het
Cdh8	T	A	8: 99,098,870	N498Y	probably damaging	Het
Cdkn3	A	G	14: 46,769,834		probably null	Het
Celf2	A	T	2: 6,615,753	M40K	probably damaging	Het
Cfap57	A	C	4: 118,615,010	S57R	probably damaging	Het
Cfh	A	G	1: 140,136,141		probably null	Het
Chdh	A	G	14: 30,032,788	S252G	probably benign	Het
Col8a1	T	A	16: 57,627,924	I408F	unknown	Het
Corin	C	T	5: 72,358,403	C303Y	probably damaging	Het
Crlf2	C	T	5: 109,557,141	C66Y	possibly damaging	Het
Csmd1	C	T	8: 16,233,998		probably null	Het
Cyp4f16	T	C	17: 32,545,044	V270A	probably damaging	Het
Defa29	T	A	8: 21,326,012	H113L	possibly damaging	Het
Dhx35	A	T	2: 158,842,307	N501Y	probably damaging	Het
Dst	A	G	1: 34,291,850	R4690G	probably damaging	Het
Elac2	T	A	11: 64,994,263	D439E	probably benign	Het
Ercc6	A	G	14: 32,576,803	R1383G	probably damaging	Het
Fam69b	A	G	2: 26,632,704	E55G	probably damaging	Het
Fat3	T	A	9: 15,969,988	Y3196F	probably damaging	Het
Fbxw13	A	T	9: 109,181,543	D342E	probably benign	Het
Fmod	A	G	1: 134,040,720	N166S	possibly damaging	Het
Folh1	A	G	7: 86,762,967	S199P	possibly damaging	Het
Fv1	A	G	4: 147,869,778	N267S	possibly damaging	Het
Fyn	T	C	10: 39,526,832	V200A	possibly damaging	Het
Ggnbp2	T	C	11: 84,862,296	N39S	probably benign	Het
Gm10509	A	T	17: 21,690,924	I53F	possibly damaging	Het
Gpr139	A	T	7: 119,144,879	I161N	possibly damaging	Het
Grhl2	C	T	15: 37,358,407	T148I	probably damaging	Het
Hmcn1	C	A	1: 150,604,882	M4514I	probably benign	Het
Igsf10	T	G	3: 59,329,572	T1063P	probably benign	Het
Itgav	A	G	2: 83,795,486	Y792C	possibly damaging	Het
Itgb2l	T	C	16: 96,426,935	Q456R	probably benign	Het
Jph4	G	A	14: 55,108,361	A613V	probably benign	Het
Kcna2	A	G	3: 107,105,401	T433A	probably benign	Het
Kmt2e	A	G	5: 23,492,395	K97R	probably benign	Het
Krba1	C	A	6: 48,415,765	A871E	probably benign	Het
Loxhd1	T	C	18: 77,340,137	F468L	probably benign	Het
Lpin1	A	G	12: 16,546,727	V713A	probably damaging	Het
Ltbp2	T	A	12: 84,785,863	I67F	probably damaging	Het
Mdc1	G	A	17: 35,844,538	R35H	probably benign	Het
Mdc1	A	G	17: 35,850,811	D872G	probably benign	Het
Mgam	C	T	6: 40,764,185	Q959*	probably null	Het
Mttp	T	A	3: 138,116,027	T260S	probably benign	Het
Naalad2	A	T	9: 18,376,535	D266E	probably benign	Het
Nans	T	A	4: 46,500,162	L182H	probably damaging	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nfix	A	T	8: 84,721,677	V407E	probably damaging	Het
Nktr	T	A	9: 121,750,240		probably benign	Het
Nlrp10	G	A	7: 108,925,395	R293*	probably null	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1126	T	C	2: 87,457,383	S73P	probably damaging	Het
Olfr212	A	G	6: 116,515,989	T71A	probably benign	Het
Olfr380	A	T	11: 73,453,994	F73I	probably damaging	Het
Olfr402	T	C	11: 74,155,885	C244R	probably damaging	Het
Olfr452	T	C	6: 42,790,477	I146T	probably benign	Het
Olfr493	A	G	7: 108,346,807	L58P	probably damaging	Het
Olfr749	G	A	14: 50,736,778	P128L	probably damaging	Het
Olfr994	T	A	2: 85,430,260	N190Y	probably damaging	Het
Oxld1	A	G	11: 120,456,906	V155A	probably damaging	Het
Pamr1	T	A	2: 102,642,300	F648Y	probably damaging	Het
Parg	T	C	14: 32,210,540	W446R	probably damaging	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Phf7	T	C	14: 31,240,324	I175V	possibly damaging	Het
Pibf1	G	A	14: 99,187,809		probably null	Het
Plcxd1	A	G	5: 110,103,442	I295V	probably benign	Het
Pole2	A	C	12: 69,209,990	Y254D	probably damaging	Het
Ppm1e	T	A	11: 87,244,370	I225F	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnase2b	T	G	14: 51,162,900	V146G	probably damaging	Het
Rnf169	G	A	7: 99,926,254	T378I	probably damaging	Het
Rpf2	A	G	10: 40,236,201	F80L	probably benign	Het
Sec11c	T	A	18: 65,814,874	D128E	probably damaging	Het
Sept12	A	G	16: 4,988,553	V248A	probably damaging	Het
Serinc1	T	C	10: 57,525,451	N82S	probably benign	Het
Serpina9	A	C	12: 104,001,249	W296G	probably damaging	Het
Sgo2b	A	C	8: 63,931,469	D164E	probably damaging	Het
Slc15a3	A	G	19: 10,848,613	N223D	probably damaging	Het
Slc44a3	A	G	3: 121,532,166	Y12H	probably benign	Het
Slco3a1	A	G	7: 74,504,611	F42S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Sorl1	A	T	9: 42,081,950	D259E	probably damaging	Het
Stpg2	G	A	3: 139,522,981		probably null	Het
Strn	T	A	17: 78,684,395	Y165F	probably damaging	Het
Sval2	T	A	6: 41,864,320	*106R	probably null	Het
Tcaf3	A	G	6: 42,596,688	S197P	possibly damaging	Het
Tespa1	C	A	10: 130,354,723	T73N	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Thoc5	C	A	11: 4,915,561	T380K	probably benign	Het
Tmprss7	T	A	16: 45,656,548	R784*	probably null	Het
Trank1	A	T	9: 111,390,709	L2171F	probably benign	Het
Trpm2	T	G	10: 77,945,876	K303T	probably benign	Het
Tsta3	A	T	15: 75,925,649	D278E	possibly damaging	Het
Unc80	G	A	1: 66,510,625	V681M	probably damaging	Het
Usp40	A	G	1: 87,946,646	F1131L	probably benign	Het
Vmn1r215	A	T	13: 23,076,503	I238F	possibly damaging	Het
Vwa3a	A	T	7: 120,795,627	Y890F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,860	L234P	probably damaging	Het
Zfp109	A	G	7: 24,228,251	S578P	probably damaging	Het
Zfp704	T	C	3: 9,609,358	D121G	unknown	Het
Zgrf1	G	T	3: 127,563,137	V671L	probably benign	Het
Zkscan8	A	T	13: 21,520,757	C265*	probably null	Het
Zscan26	T	C	13: 21,445,140	I398V	possibly damaging	Het

Other mutations in Ahnak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Ahnak	APN	19	9007223	missense	probably damaging	0.99
IGL00509:Ahnak	APN	19	9009951	missense	possibly damaging	0.94
IGL00539:Ahnak	APN	19	9007908	missense	possibly damaging	0.50
IGL00558:Ahnak	APN	19	9004307	missense	possibly damaging	0.93
IGL00567:Ahnak	APN	19	9013383	missense	probably benign	0.24
IGL00706:Ahnak	APN	19	9013730	nonsense	probably null
IGL00807:Ahnak	APN	19	9008522	missense	possibly damaging	0.92
IGL00870:Ahnak	APN	19	9013698	missense	probably damaging	1.00
IGL01101:Ahnak	APN	19	9012887	intron	probably benign
IGL01118:Ahnak	APN	19	9012578	missense	probably damaging	1.00
IGL01288:Ahnak	APN	19	9002494	missense	possibly damaging	0.94
IGL01324:Ahnak	APN	19	9003032	missense	probably damaging	1.00
IGL01341:Ahnak	APN	19	9011703	missense	probably benign
IGL01541:Ahnak	APN	19	9007879	missense	possibly damaging	0.95
IGL01580:Ahnak	APN	19	9002839	missense	probably benign	0.02
IGL01595:Ahnak	APN	19	9003501	nonsense	probably null
IGL01746:Ahnak	APN	19	9004912	missense	possibly damaging	0.89
IGL01766:Ahnak	APN	19	9000118	missense	unknown
IGL01821:Ahnak	APN	19	9012118	missense	probably benign
IGL01913:Ahnak	APN	19	9006064	nonsense	probably null
IGL01934:Ahnak	APN	19	9002657	missense	probably damaging	1.00
IGL01940:Ahnak	APN	19	9006557	missense	probably benign	0.14
IGL01958:Ahnak	APN	19	9014909	missense	possibly damaging	0.59
IGL02145:Ahnak	APN	19	9002855	missense	probably benign	0.11
IGL02246:Ahnak	APN	19	9008268	missense	probably damaging	1.00
IGL02282:Ahnak	APN	19	9005987	missense	probably damaging	1.00
IGL02428:Ahnak	APN	19	9014833	missense	possibly damaging	0.83
IGL02442:Ahnak	APN	19	9004016	missense	probably damaging	1.00
IGL02474:Ahnak	APN	19	9004933	missense	probably benign	0.13
IGL02483:Ahnak	APN	19	9003308	missense	probably benign	0.01
IGL02616:Ahnak	APN	19	9005627	missense	probably benign	0.03
IGL02630:Ahnak	APN	19	9012077	missense	probably damaging	1.00
IGL02690:Ahnak	APN	19	9012584	nonsense	probably null
IGL02717:Ahnak	APN	19	9002387	missense	probably benign	0.00
IGL02721:Ahnak	APN	19	9009707	missense	probably benign	0.07
IGL02737:Ahnak	APN	19	9004593	missense	probably benign	0.17
IGL02850:Ahnak	APN	19	9002596	missense	probably benign	0.00
IGL03071:Ahnak	APN	19	9011918	missense	possibly damaging	0.63
IGL03072:Ahnak	APN	19	9006508	missense	probably benign	0.11
IGL03094:Ahnak	APN	19	9003547	missense	possibly damaging	0.64
IGL03140:Ahnak	APN	19	9005212	intron	probably benign
IGL03176:Ahnak	APN	19	9008166	missense	possibly damaging	0.56
IGL03176:Ahnak	APN	19	9002449	missense	probably damaging	1.00
IGL03189:Ahnak	APN	19	9011239	missense	possibly damaging	0.65
IGL03357:Ahnak	APN	19	9009325	intron	probably benign
IGL03371:Ahnak	APN	19	9004228	missense	possibly damaging	0.91
Eskimo	UTSW	19	9009574	missense	probably benign	0.31
Nanook	UTSW	19	9003231	missense	probably benign	0.42
Netsilik	UTSW	19	9002321	missense	probably benign	0.00
IGL03097:Ahnak	UTSW	19	9002387	missense	probably benign	0.00
PIT4403001:Ahnak	UTSW	19	9006176	missense	possibly damaging	0.87
R0054:Ahnak	UTSW	19	9012056	missense	probably damaging	1.00
R0094:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R0110:Ahnak	UTSW	19	9018232	nonsense	probably null
R0141:Ahnak	UTSW	19	9006680	missense	probably damaging	1.00
R0166:Ahnak	UTSW	19	9005725	missense	probably damaging	1.00
R0309:Ahnak	UTSW	19	9002495	missense	probably damaging	1.00
R0368:Ahnak	UTSW	19	9008350	nonsense	probably null
R0386:Ahnak	UTSW	19	9011144	missense	possibly damaging	0.94
R0401:Ahnak	UTSW	19	9015116	missense	probably benign	0.24
R0415:Ahnak	UTSW	19	9012871	intron	probably benign
R0463:Ahnak	UTSW	19	9009407	intron	probably benign
R0469:Ahnak	UTSW	19	9018232	nonsense	probably null
R0470:Ahnak	UTSW	19	9008967	missense	probably benign	0.29
R0487:Ahnak	UTSW	19	9007151	missense	probably benign	0.00
R0487:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R0499:Ahnak	UTSW	19	9000264	splice site	probably benign
R0506:Ahnak	UTSW	19	9009128	missense	probably damaging	1.00
R0510:Ahnak	UTSW	19	9018232	nonsense	probably null
R0557:Ahnak	UTSW	19	9001944	missense	probably benign	0.10
R0570:Ahnak	UTSW	19	9013698	missense	probably damaging	1.00
R0610:Ahnak	UTSW	19	9007878	missense	probably benign	0.08
R0646:Ahnak	UTSW	19	9013402	nonsense	probably null
R0659:Ahnak	UTSW	19	9015002	missense	possibly damaging	0.60
R0791:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0792:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0840:Ahnak	UTSW	19	9005063	missense	probably damaging	1.00
R0847:Ahnak	UTSW	19	9006433	nonsense	probably null
R0941:Ahnak	UTSW	19	9009914	missense	probably damaging	1.00
R0962:Ahnak	UTSW	19	9012848	intron	probably benign
R1017:Ahnak	UTSW	19	9010543	missense	probably damaging	0.99
R1037:Ahnak	UTSW	19	9007618	missense	probably benign	0.27
R1085:Ahnak	UTSW	19	9013125	missense	possibly damaging	0.50
R1113:Ahnak	UTSW	19	9005620	missense	probably benign	0.29
R1140:Ahnak	UTSW	19	9004245	missense	probably damaging	1.00
R1158:Ahnak	UTSW	19	9013926	missense	probably benign	0.00
R1218:Ahnak	UTSW	19	9015619	missense	probably damaging	1.00
R1225:Ahnak	UTSW	19	9002883	missense	probably damaging	1.00
R1245:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R1421:Ahnak	UTSW	19	9015631	missense	possibly damaging	0.95
R1447:Ahnak	UTSW	19	9007082	missense	probably damaging	0.98
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1471:Ahnak	UTSW	19	9012932	intron	probably benign
R1507:Ahnak	UTSW	19	9010077	missense	probably damaging	1.00
R1521:Ahnak	UTSW	19	9004728	missense	probably benign	0.11
R1568:Ahnak	UTSW	19	9002375	missense	probably damaging	0.98
R1569:Ahnak	UTSW	19	9004094	missense	possibly damaging	0.78
R1616:Ahnak	UTSW	19	9008987	missense	possibly damaging	0.94
R1638:Ahnak	UTSW	19	9009449	missense	probably benign	0.01
R1680:Ahnak	UTSW	19	9009963	missense	probably benign	0.05
R1713:Ahnak	UTSW	19	9011809	missense	possibly damaging	0.95
R1722:Ahnak	UTSW	19	9010655	missense	probably damaging	0.99
R1771:Ahnak	UTSW	19	9013753	missense	probably benign	0.24
R1795:Ahnak	UTSW	19	9002438	missense	possibly damaging	0.79
R1823:Ahnak	UTSW	19	9004905	missense	probably damaging	0.99
R1842:Ahnak	UTSW	19	9005867	missense	probably damaging	0.99
R1854:Ahnak	UTSW	19	9013832	missense	possibly damaging	0.61
R1856:Ahnak	UTSW	19	9002048	missense	possibly damaging	0.86
R1886:Ahnak	UTSW	19	9015979	missense	probably damaging	0.98
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1913:Ahnak	UTSW	19	9007922	missense	probably damaging	0.99
R1942:Ahnak	UTSW	19	9015083	missense	probably damaging	0.98
R1987:Ahnak	UTSW	19	9015251	missense	probably damaging	1.00
R2006:Ahnak	UTSW	19	9007075	missense	probably damaging	1.00
R2013:Ahnak	UTSW	19	9014573	missense	probably damaging	0.98
R2014:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R2047:Ahnak	UTSW	19	9014300	missense	possibly damaging	0.67
R2048:Ahnak	UTSW	19	9007056	missense	probably damaging	0.99
R2060:Ahnak	UTSW	19	9008041	missense	probably benign	0.08
R2083:Ahnak	UTSW	19	9011557	missense	probably damaging	1.00
R2157:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R2167:Ahnak	UTSW	19	9011494	nonsense	probably null
R2208:Ahnak	UTSW	19	9017732	missense	probably benign	0.00
R2224:Ahnak	UTSW	19	9012991	intron	probably benign
R2268:Ahnak	UTSW	19	9010574	missense	possibly damaging	0.66
R2420:Ahnak	UTSW	19	9009256	missense	possibly damaging	0.89
R2426:Ahnak	UTSW	19	9002851	missense	possibly damaging	0.81
R2910:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2911:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2981:Ahnak	UTSW	19	9000148	missense	probably damaging	0.97
R3151:Ahnak	UTSW	19	9009944	missense	probably benign	0.12
R3155:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R3422:Ahnak	UTSW	19	9005708	missense	probably benign	0.39
R3422:Ahnak	UTSW	19	9006752	missense	probably benign	0.05
R3430:Ahnak	UTSW	19	9006958	missense	probably benign	0.42
R3433:Ahnak	UTSW	19	9009994	missense	probably benign	0.01
R3711:Ahnak	UTSW	19	9007898	missense	probably benign
R3723:Ahnak	UTSW	19	9016853	missense	possibly damaging	0.79
R3775:Ahnak	UTSW	19	9009023	missense	possibly damaging	0.91
R3858:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3859:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3922:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3924:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3926:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R4026:Ahnak	UTSW	19	9011299	missense	probably damaging	0.97
R4051:Ahnak	UTSW	19	9014327	missense	probably damaging	1.00
R4209:Ahnak	UTSW	19	9002600	missense	probably damaging	1.00
R4234:Ahnak	UTSW	19	9000786	nonsense	probably null
R4237:Ahnak	UTSW	19	9001783	missense	probably benign	0.02
R4285:Ahnak	UTSW	19	9016839	nonsense	probably null
R4331:Ahnak	UTSW	19	9015820	missense	probably damaging	1.00
R4342:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R4430:Ahnak	UTSW	19	9003040	missense	probably benign	0.00
R4554:Ahnak	UTSW	19	9014930	missense	probably damaging	1.00
R4602:Ahnak	UTSW	19	9010825	missense	possibly damaging	0.66
R4612:Ahnak	UTSW	19	9003724	missense	probably benign	0.44
R4655:Ahnak	UTSW	19	9008701	missense	probably damaging	1.00
R4656:Ahnak	UTSW	19	9004855	missense	possibly damaging	0.80
R4700:Ahnak	UTSW	19	9004681	missense	probably benign	0.02
R4704:Ahnak	UTSW	19	9012258	intron	probably benign
R4704:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R4705:Ahnak	UTSW	19	9016906	missense	probably benign	0.07
R4707:Ahnak	UTSW	19	9016735	missense	probably benign	0.03
R4732:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4733:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4778:Ahnak	UTSW	19	9011975	missense	possibly damaging	0.79
R4782:Ahnak	UTSW	19	9012499	intron	probably benign
R4832:Ahnak	UTSW	19	9012460	intron	probably benign
R4882:Ahnak	UTSW	19	9005897	missense	probably damaging	0.98
R4884:Ahnak	UTSW	19	9012754	intron	probably benign
R4895:Ahnak	UTSW	19	9017441	missense	probably benign	0.43
R4930:Ahnak	UTSW	19	9010967	missense	possibly damaging	0.79
R4951:Ahnak	UTSW	19	9017835	missense	probably damaging	1.00
R4968:Ahnak	UTSW	19	9015100	missense	probably damaging	1.00
R5026:Ahnak	UTSW	19	9010631	missense	possibly damaging	0.46
R5050:Ahnak	UTSW	19	9012458	intron	probably benign
R5073:Ahnak	UTSW	19	9003231	missense	probably benign	0.42
R5110:Ahnak	UTSW	19	9014759	missense	probably damaging	1.00
R5119:Ahnak	UTSW	19	9013644	missense	probably benign	0.00
R5128:Ahnak	UTSW	19	9017087	missense	probably damaging	1.00
R5139:Ahnak	UTSW	19	9004655	missense	probably damaging	1.00
R5150:Ahnak	UTSW	19	9010904	missense	possibly damaging	0.46
R5151:Ahnak	UTSW	19	9017569	missense	probably benign	0.03
R5165:Ahnak	UTSW	19	9015665	missense	possibly damaging	0.95
R5236:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R5361:Ahnak	UTSW	19	9015341	missense	possibly damaging	0.92
R5366:Ahnak	UTSW	19	9016735	missense	possibly damaging	0.65
R5387:Ahnak	UTSW	19	9003691	missense	probably damaging	1.00
R5396:Ahnak	UTSW	19	9007175	missense	probably damaging	0.99
R5583:Ahnak	UTSW	19	9006917	missense	probably damaging	0.99
R5587:Ahnak	UTSW	19	9009476	missense	possibly damaging	0.88
R5620:Ahnak	UTSW	19	9013094	nonsense	probably null
R5643:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5644:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5657:Ahnak	UTSW	19	9014615	missense	probably damaging	0.99
R5688:Ahnak	UTSW	19	9002519	missense	probably benign	0.01
R5702:Ahnak	UTSW	19	9001840	missense	probably damaging	1.00
R5727:Ahnak	UTSW	19	9016747	missense	probably damaging	0.99
R5730:Ahnak	UTSW	19	9010253	missense	possibly damaging	0.81
R5755:Ahnak	UTSW	19	9001732	missense	probably benign	0.06
R5760:Ahnak	UTSW	19	9013562	missense	probably damaging	1.00
R5789:Ahnak	UTSW	19	9002321	missense	probably benign	0.00
R5790:Ahnak	UTSW	19	9015248	missense	probably damaging	0.99
R5795:Ahnak	UTSW	19	9012382	nonsense	probably null
R5808:Ahnak	UTSW	19	9010235	missense	possibly damaging	0.91
R5867:Ahnak	UTSW	19	9010052	missense	probably damaging	0.99
R5878:Ahnak	UTSW	19	9008342	missense	probably damaging	1.00
R5898:Ahnak	UTSW	19	9013767	missense	possibly damaging	0.63
R5898:Ahnak	UTSW	19	9018211	missense	probably damaging	1.00
R5912:Ahnak	UTSW	19	9011903	missense	probably damaging	0.99
R5935:Ahnak	UTSW	19	9015182	missense	possibly damaging	0.91
R5969:Ahnak	UTSW	19	9016585	missense	probably damaging	1.00
R5988:Ahnak	UTSW	19	9009347	intron	probably benign
R6000:Ahnak	UTSW	19	9013111	nonsense	probably null
R6005:Ahnak	UTSW	19	9015161	missense	possibly damaging	0.61
R6101:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6105:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6116:Ahnak	UTSW	19	9012963	intron	probably benign
R6209:Ahnak	UTSW	19	9012566	missense	probably damaging	1.00
R6240:Ahnak	UTSW	19	9013583	missense	probably damaging	1.00
R6255:Ahnak	UTSW	19	9008025	missense	possibly damaging	0.95
R6263:Ahnak	UTSW	19	9018277	missense	probably benign	0.03
R6287:Ahnak	UTSW	19	9015003	missense	probably benign	0.02
R6296:Ahnak	UTSW	19	9003305	missense	probably damaging	0.99
R6315:Ahnak	UTSW	19	9006626	missense	probably damaging	0.99
R6328:Ahnak	UTSW	19	9007148	missense	probably benign	0.11
R6331:Ahnak	UTSW	19	9006625	missense	probably benign	0.18
R6355:Ahnak	UTSW	19	9008762	missense	probably benign	0.02
R6409:Ahnak	UTSW	19	9009574	missense	probably benign	0.31
R6567:Ahnak	UTSW	19	9008806	missense	probably benign	0.27
R6572:Ahnak	UTSW	19	9007976	missense	probably damaging	0.99
R6574:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R6590:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6620:Ahnak	UTSW	19	9015310	missense	possibly damaging	0.95
R6690:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6731:Ahnak	UTSW	19	9011562	missense	possibly damaging	0.85
R6756:Ahnak	UTSW	19	9007561	missense	possibly damaging	0.59
R6846:Ahnak	UTSW	19	9011857	missense	possibly damaging	0.66
R6854:Ahnak	UTSW	19	9015235	missense	probably damaging	1.00
R6857:Ahnak	UTSW	19	9037168	nonsense	probably null
R6863:Ahnak	UTSW	19	9012365	intron	probably benign
R6876:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R6958:Ahnak	UTSW	19	9015215	missense	possibly damaging	0.88
R7126:Ahnak	UTSW	19	9002359	missense	possibly damaging	0.61
R7181:Ahnak	UTSW	19	9013488	missense	probably damaging	1.00
R7183:Ahnak	UTSW	19	9017668	missense	probably damaging	1.00
R7202:Ahnak	UTSW	19	9017799	missense	probably damaging	1.00
R7235:Ahnak	UTSW	19	9012488	missense	unknown
R7241:Ahnak	UTSW	19	9009031	missense	possibly damaging	0.65
R7269:Ahnak	UTSW	19	9006617	missense	probably damaging	1.00
R7311:Ahnak	UTSW	19	9002143	missense	probably benign	0.04
R7311:Ahnak	UTSW	19	9009827	missense	possibly damaging	0.56
R7329:Ahnak	UTSW	19	9001792	missense	probably damaging	0.99
R7339:Ahnak	UTSW	19	9008165	missense	possibly damaging	0.75
R7390:Ahnak	UTSW	19	9003205	missense	probably benign	0.02
R7400:Ahnak	UTSW	19	9014613	missense	probably damaging	0.99
R7444:Ahnak	UTSW	19	9007423	missense	probably benign	0.08
R7483:Ahnak	UTSW	19	9004822	missense	probably damaging	1.00
R7498:Ahnak	UTSW	19	9012019	missense	probably benign	0.14
R7521:Ahnak	UTSW	19	9002351	missense	possibly damaging	0.89
R7522:Ahnak	UTSW	19	9002322	missense	probably benign	0.01
R7552:Ahnak	UTSW	19	9006824	missense	probably benign	0.18
R7563:Ahnak	UTSW	19	9011165	missense	probably damaging	0.99
R7565:Ahnak	UTSW	19	9016156	missense	probably benign	0.05
R7571:Ahnak	UTSW	19	9000786	nonsense	probably null
R7583:Ahnak	UTSW	19	9006093	missense	possibly damaging	0.90
R7600:Ahnak	UTSW	19	9004574	missense	possibly damaging	0.89
R7771:Ahnak	UTSW	19	9015047	missense	probably damaging	0.99
R7787:Ahnak	UTSW	19	9009315	missense	unknown
R7827:Ahnak	UTSW	19	9005344	nonsense	probably null
R7857:Ahnak	UTSW	19	9007468	missense	probably damaging	0.97
R7916:Ahnak	UTSW	19	9005832	missense	possibly damaging	0.66
R7939:Ahnak	UTSW	19	9014084	nonsense	probably null
R7959:Ahnak	UTSW	19	9010649	missense	possibly damaging	0.46
R7962:Ahnak	UTSW	19	9012800	missense	unknown
R7979:Ahnak	UTSW	19	9011432	missense	probably damaging	1.00
R8006:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R8013:Ahnak	UTSW	19	9009335	missense	unknown
R8033:Ahnak	UTSW	19	9003710	missense	probably benign	0.10
R8124:Ahnak	UTSW	19	9007123	missense	probably damaging	0.99
R8125:Ahnak	UTSW	19	9011876	missense	possibly damaging	0.95
R8129:Ahnak	UTSW	19	9000100	start codon destroyed	not run
R8151:Ahnak	UTSW	19	9004679	missense	possibly damaging	0.59
R8190:Ahnak	UTSW	19	9002255	missense	probably benign	0.01
R8221:Ahnak	UTSW	19	9010436	nonsense	probably null
R8241:Ahnak	UTSW	19	9007295	missense	probably benign	0.15
R8244:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8248:Ahnak	UTSW	19	9001946	missense	probably damaging	1.00
R8261:Ahnak	UTSW	19	9005453	missense	probably damaging	1.00
R8330:Ahnak	UTSW	19	9009662	missense	possibly damaging	0.86
R8380:Ahnak	UTSW	19	9017855	missense	probably benign	0.05
R8407:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8409:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8463:Ahnak	UTSW	19	9008749	missense	probably benign	0.07
R8511:Ahnak	UTSW	19	9012355	missense	unknown
R8528:Ahnak	UTSW	19	9007728	missense	probably damaging	1.00
R8549:Ahnak	UTSW	19	9011483	missense	probably damaging	1.00
R8674:Ahnak	UTSW	19	9005996	missense	probably damaging	0.98
R8716:Ahnak	UTSW	19	9009074	missense	probably damaging	1.00
R8722:Ahnak	UTSW	19	9013346	nonsense	probably null
R8751:Ahnak	UTSW	19	9010145	missense	probably damaging	1.00
R8752:Ahnak	UTSW	19	9015537	missense	probably damaging	1.00
R8783:Ahnak	UTSW	19	9011473	missense	probably damaging	1.00
R8844:Ahnak	UTSW	19	9006890	missense	probably damaging	1.00
R8859:Ahnak	UTSW	19	9007203	missense	probably damaging	1.00
R8882:Ahnak	UTSW	19	9000742	missense	probably damaging	1.00
R8907:Ahnak	UTSW	19	9009088	missense	probably benign	0.24
R8938:Ahnak	UTSW	19	9011735	missense	probably benign	0.00
R8975:Ahnak	UTSW	19	9012737	missense	probably damaging	1.00
R8983:Ahnak	UTSW	19	9004113	missense	possibly damaging	0.75
R9017:Ahnak	UTSW	19	9010123	missense	probably damaging	1.00
R9027:Ahnak	UTSW	19	9007253	missense	possibly damaging	0.94
R9081:Ahnak	UTSW	19	9008526	missense	possibly damaging	0.81
R9104:Ahnak	UTSW	19	9010347	missense	probably benign	0.01
R9112:Ahnak	UTSW	19	9009785	missense	probably damaging	0.98
R9145:Ahnak	UTSW	19	9014923	missense	probably benign	0.38
R9189:Ahnak	UTSW	19	9010883	missense	possibly damaging	0.92
R9221:Ahnak	UTSW	19	9012579	missense	probably damaging	1.00
R9261:Ahnak	UTSW	19	9016139	missense	possibly damaging	0.63
R9299:Ahnak	UTSW	19	9012460	intron	probably benign
R9325:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R9337:Ahnak	UTSW	19	9012460	intron	probably benign
R9340:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R9351:Ahnak	UTSW	19	9007868	missense	probably damaging	1.00
R9416:Ahnak	UTSW	19	9012902	missense	unknown
R9462:Ahnak	UTSW	19	9003935	missense	probably damaging	0.96
R9469:Ahnak	UTSW	19	9010861	missense	probably damaging	1.00
R9485:Ahnak	UTSW	19	9002074	missense	probably benign	0.16
R9503:Ahnak	UTSW	19	9010094	missense	probably damaging	1.00
R9524:Ahnak	UTSW	19	9037253	missense
R9534:Ahnak	UTSW	19	9003612	missense	probably benign	0.20
R9598:Ahnak	UTSW	19	9003785	missense	probably benign	0.42
R9611:Ahnak	UTSW	19	9011798	missense	probably damaging	0.99
R9624:Ahnak	UTSW	19	9012482	missense	unknown
R9649:Ahnak	UTSW	19	9008422	nonsense	probably null
R9683:Ahnak	UTSW	19	9007355	missense	possibly damaging	0.94
R9691:Ahnak	UTSW	19	9011726	missense	possibly damaging	0.49
R9712:Ahnak	UTSW	19	9007028	small deletion	probably benign
R9712:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9713:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9715:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9725:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R9725:Ahnak	UTSW	19	9014243	missense	probably damaging	1.00
R9747:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R9798:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
RF007:Ahnak	UTSW	19	9013601	missense	possibly damaging	0.45
X0021:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
X0027:Ahnak	UTSW	19	9012037	missense	probably damaging	1.00
Z1088:Ahnak	UTSW	19	9016082	missense	probably damaging	0.99
Z1176:Ahnak	UTSW	19	9008856	missense	probably damaging	0.97
Z1177:Ahnak	UTSW	19	9017468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAGTGGATGTCAACTTCCC -3'
(R):5'- AAACTTCAGCTTTCCATGCTTG -3'

Sequencing Primer
(F):5'- CTTCCCTAAAGTGGAGGCCAATG -3'
(R):5'- AACTCCAAAGTCCCAGTTGG -3'

Posted On

2014-06-30