Incidental Mutation 'R0121:Tmtc3'
ID21047
Institutional Source Beutler Lab
Gene Symbol Tmtc3
Ensembl Gene ENSMUSG00000036676
Gene Nametransmembrane and tetratricopeptide repeat containing 3
SynonymsB130008E12Rik, mSmile, 9130014E20Rik
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R0121 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location100443902-100487350 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 100458908 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058154] [ENSMUST00000099318]
Predicted Effect probably benign
Transcript: ENSMUST00000058154
SMART Domains Protein: ENSMUSP00000061470
Gene: ENSMUSG00000036676

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 263 336 5.4e-35 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
TPR 673 706 1.35e-1 SMART
TPR 707 740 1.44e1 SMART
TPR 741 775 1.51e1 SMART
TPR 776 809 9e1 SMART
low complexity region 867 880 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099318
SMART Domains Protein: ENSMUSP00000096921
Gene: ENSMUSG00000036676

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 261 338 2.6e-33 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the transmembrane and tetratricopeptide repeat-containing protein family. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired bronchial smooth muscle and alveolar myofibroblast development that leads to cyanosis and postnatal lethality in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Tmtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tmtc3 APN 10 100471480 missense probably benign
IGL00962:Tmtc3 APN 10 100471953 missense probably damaging 1.00
IGL01670:Tmtc3 APN 10 100447125 missense probably benign 0.02
IGL01729:Tmtc3 APN 10 100447155 missense probably benign
IGL01933:Tmtc3 APN 10 100447605 missense probably benign 0.00
IGL01961:Tmtc3 APN 10 100447031 missense probably benign
IGL03063:Tmtc3 APN 10 100447606 missense probably benign 0.00
IGL03176:Tmtc3 APN 10 100466131 missense possibly damaging 0.57
IGL03195:Tmtc3 APN 10 100459034 missense probably benign 0.00
IGL03238:Tmtc3 APN 10 100477840 missense probably damaging 1.00
IGL03272:Tmtc3 APN 10 100457080 missense probably benign 0.00
IGL03335:Tmtc3 APN 10 100466254 missense probably damaging 0.97
IGL03375:Tmtc3 APN 10 100447719 missense possibly damaging 0.67
IGL03409:Tmtc3 APN 10 100451432 missense possibly damaging 0.75
R0078:Tmtc3 UTSW 10 100448961 missense probably damaging 1.00
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0480:Tmtc3 UTSW 10 100471404 missense probably damaging 1.00
R1136:Tmtc3 UTSW 10 100472043 unclassified probably benign
R1203:Tmtc3 UTSW 10 100476744 missense probably damaging 1.00
R1253:Tmtc3 UTSW 10 100451390 missense probably benign 0.05
R2181:Tmtc3 UTSW 10 100448973 missense probably benign 0.00
R3011:Tmtc3 UTSW 10 100447582 missense possibly damaging 0.76
R3430:Tmtc3 UTSW 10 100447575 missense probably benign 0.29
R3910:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3911:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3912:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R4773:Tmtc3 UTSW 10 100457139 missense possibly damaging 0.66
R4838:Tmtc3 UTSW 10 100466220 missense probably damaging 1.00
R4996:Tmtc3 UTSW 10 100447224 missense probably damaging 0.99
R5131:Tmtc3 UTSW 10 100448979 missense probably damaging 1.00
R5976:Tmtc3 UTSW 10 100476672 missense probably benign 0.00
R6700:Tmtc3 UTSW 10 100471477 missense probably benign 0.00
R7187:Tmtc3 UTSW 10 100477912 missense probably damaging 1.00
R7211:Tmtc3 UTSW 10 100447605 missense probably benign 0.05
R7299:Tmtc3 UTSW 10 100447474 missense not run
R7301:Tmtc3 UTSW 10 100447474 missense not run
R7329:Tmtc3 UTSW 10 100447419 missense probably benign 0.00
R7509:Tmtc3 UTSW 10 100466094 missense probably damaging 1.00
R7614:Tmtc3 UTSW 10 100450352 nonsense probably null
R8329:Tmtc3 UTSW 10 100447434 missense probably damaging 0.99
R8394:Tmtc3 UTSW 10 100446946 missense probably damaging 1.00
R8771:Tmtc3 UTSW 10 100450318 missense possibly damaging 0.80
RF023:Tmtc3 UTSW 10 100477866 missense probably benign
Z1176:Tmtc3 UTSW 10 100471456 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CATTCCCAATAGTGCTGAACCAGTGATA -3'
(R):5'- CAGTTGGTGGGCCATCTTCGTAA -3'

Sequencing Primer
(F):5'- agccattgaaaggcaaaaaaac -3'
(R):5'- CTTCTAAGGAAAAATGGTTTTGGTG -3'
Posted On2013-04-11