Incidental Mutation 'R1869:Agbl4'
ID210511
Institutional Source Beutler Lab
Gene Symbol Agbl4
Ensembl Gene ENSMUSG00000061298
Gene NameATP/GTP binding protein-like 4
Synonyms4931433A01Rik, 4930578N11Rik
MMRRC Submission 039891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1869 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location110397661-111664324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111566629 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 284 (M284K)
Ref Sequence ENSEMBL: ENSMUSP00000095533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080744] [ENSMUST00000097920] [ENSMUST00000106591] [ENSMUST00000106592]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080744
AA Change: M284K

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079568
Gene: ENSMUSG00000061298
AA Change: M284K

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097920
AA Change: M284K

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095533
Gene: ENSMUSG00000061298
AA Change: M284K

DomainStartEndE-ValueType
Zn_pept 169 465 3.6e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106591
AA Change: M284K

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102201
Gene: ENSMUSG00000061298
AA Change: M284K

DomainStartEndE-ValueType
Pfam:Peptidase_M14 174 321 3.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106592
AA Change: M284K

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102202
Gene: ENSMUSG00000061298
AA Change: M284K

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142460
Predicted Effect unknown
Transcript: ENSMUST00000148038
AA Change: M129K
SMART Domains Protein: ENSMUSP00000118551
Gene: ENSMUSG00000061298
AA Change: M129K

DomainStartEndE-ValueType
Zn_pept 15 267 9.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154123
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal platelet morphology and physiology, impaired megakaryopoiesis, increased spleen weight and increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,890,067 L110P probably damaging Het
6030458C11Rik T C 15: 12,817,907 D168G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abhd11 A G 5: 135,011,617 Y168C probably damaging Het
Actr5 A C 2: 158,638,723 T554P probably damaging Het
Adamts16 A G 13: 70,735,747 L1103P probably damaging Het
Adgrb3 A T 1: 25,826,438 I108K possibly damaging Het
Aoc3 T A 11: 101,331,467 Y176* probably null Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Ap4b1 T A 3: 103,820,868 Y399* probably null Het
Arhgef5 A T 6: 43,288,682 I1553F probably damaging Het
Bag6 T C 17: 35,142,826 V541A probably benign Het
Bdp1 A C 13: 100,042,201 V1879G probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Bsnd C T 4: 106,486,636 V158I probably benign Het
Cachd1 C A 4: 100,983,390 H880N probably damaging Het
Ccdc27 T C 4: 154,026,763 probably null Het
Cd74 C T 18: 60,810,412 P190S probably benign Het
Cep68 A T 11: 20,240,217 L265Q probably damaging Het
Cfap70 G A 14: 20,408,610 Q772* probably null Het
CK137956 T A 4: 127,970,534 S101C possibly damaging Het
Clca3a2 G A 3: 144,806,403 T524M probably benign Het
Cxcr6 T C 9: 123,809,957 S15P probably benign Het
Cyfip2 T A 11: 46,224,168 Y904F probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Ddx56 C T 11: 6,263,993 V389M possibly damaging Het
Dmp1 A T 5: 104,212,076 D206V probably damaging Het
Dnah17 A T 11: 118,047,189 C3350* probably null Het
Dpcr1 A G 17: 35,638,413 L98P possibly damaging Het
Dst A T 1: 34,252,832 S877C probably damaging Het
Ermp1 A G 19: 29,646,015 S192P possibly damaging Het
F13b G A 1: 139,510,934 D359N probably benign Het
Fam171a1 A T 2: 3,226,152 Q769L possibly damaging Het
Fap T C 2: 62,528,727 R411G probably damaging Het
Fbn1 A G 2: 125,352,027 V1340A probably benign Het
Fbxw19 T C 9: 109,482,032 I370V probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Frem2 T G 3: 53,535,196 D2640A probably benign Het
Fzd4 T C 7: 89,407,246 V167A probably benign Het
Galnt3 T C 2: 66,097,779 I258V possibly damaging Het
Galr2 T C 11: 116,283,243 V233A possibly damaging Het
Gldc G T 19: 30,139,332 Q407K probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr89 A G 3: 96,875,659 I325T probably benign Het
Grap T A 11: 61,664,189 Y61N possibly damaging Het
Hbs1l G T 10: 21,358,406 probably null Het
Hexb T A 13: 97,191,259 E134D probably benign Het
Hydin T A 8: 110,500,705 V1507D possibly damaging Het
Igkv8-16 C A 6: 70,386,987 G17V probably benign Het
Kdm4a T A 4: 118,138,871 Q987L probably null Het
Krt76 A G 15: 101,889,487 probably null Het
Lap3 T C 5: 45,503,387 S238P probably benign Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Lipn A G 19: 34,080,739 T287A possibly damaging Het
Macf1 T C 4: 123,351,128 S466G probably damaging Het
Map3k5 C A 10: 20,132,109 S1220* probably null Het
Map4 T C 9: 110,034,964 V419A probably benign Het
Map4 T A 9: 110,068,928 S754R possibly damaging Het
Mroh9 A G 1: 163,026,513 S773P probably damaging Het
Mtus1 A C 8: 41,076,230 probably null Het
Muc1 C T 3: 89,231,810 P533S probably damaging Het
Muc13 A T 16: 33,804,600 I282F probably damaging Het
Myh14 T A 7: 44,611,643 Q1816L possibly damaging Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfml2b A G 1: 170,669,243 D481G probably damaging Het
Olfr1000 A G 2: 85,608,500 S137P probably benign Het
Olfr1087 T A 2: 86,690,391 I195F probably damaging Het
Olfr309 T A 7: 86,306,667 I149F possibly damaging Het
Olfr703 T G 7: 106,845,094 I161S probably benign Het
Olfr884 T A 9: 38,048,202 probably null Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pcnt T C 10: 76,379,906 E2347G probably null Het
Phax T A 18: 56,573,104 V22D probably benign Het
Pik3ca T C 3: 32,450,350 F667S probably damaging Het
Pkd1 T C 17: 24,594,931 F4123S probably damaging Het
Pkhd1 A G 1: 20,615,267 probably null Het
Plcb1 G A 2: 135,311,014 R368K probably benign Het
Prrc2a G T 17: 35,153,308 R1739S possibly damaging Het
Psg23 A T 7: 18,614,618 M88K probably benign Het
Pstk T A 7: 131,387,797 Y354N probably damaging Het
Rab39 A G 9: 53,705,931 I62T possibly damaging Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rasgrp1 T C 2: 117,290,347 Y431C probably damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf167 T A 11: 70,650,139 I197N possibly damaging Het
Rtn1 A G 12: 72,308,168 S335P probably damaging Het
Ryr2 G T 13: 11,662,075 R3297S probably damaging Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scgb1b24 T C 7: 33,744,044 Y43H probably damaging Het
Sh3rf3 T A 10: 59,083,513 M484K probably damaging Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc1a7 A G 4: 108,008,364 T350A probably damaging Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slk T C 19: 47,625,452 F916L probably damaging Het
Snap91 T A 9: 86,790,141 probably null Het
Snrpb2 A T 2: 143,065,186 R25S possibly damaging Het
Specc1l T C 10: 75,261,825 Y811H probably damaging Het
Sprr2h A G 3: 92,386,618 probably benign Het
Sult2a5 A T 7: 13,624,120 I26F probably benign Het
Syt13 C T 2: 92,946,103 T245I possibly damaging Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Telo2 T A 17: 25,114,994 D93V probably benign Het
Tet2 A T 3: 133,481,441 probably null Het
Tgm7 A T 2: 121,101,089 C198S probably damaging Het
Ticrr T C 7: 79,679,135 F674S probably damaging Het
Tmem129 C A 5: 33,654,499 C31F probably damaging Het
Tmem132a T A 19: 10,858,688 D826V possibly damaging Het
Tpd52 T C 3: 8,953,802 probably null Het
Trub2 A G 2: 29,777,666 S321P probably benign Het
Ttc29 A G 8: 78,282,385 T295A probably benign Het
Tubb1 G A 2: 174,456,689 S89N probably benign Het
Ubap2 C A 4: 41,233,617 G91V probably damaging Het
Ugt2b35 A G 5: 87,001,288 N133D probably damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn1r220 A C 13: 23,184,287 C80G probably damaging Het
Vmn1r79 A G 7: 12,176,647 E152G probably benign Het
Vmn2r28 T C 7: 5,486,346 Y498C probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Zcchc11 T A 4: 108,529,300 F1122L probably damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zfp972 A G 2: 177,921,687 probably null Het
Other mutations in Agbl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Agbl4 APN 4 111118884 missense probably damaging 1.00
IGL02961:Agbl4 APN 4 110580121 missense probably damaging 1.00
IGL03383:Agbl4 APN 4 111657423 intron probably benign
IGL03401:Agbl4 APN 4 111119019 missense probably damaging 0.99
I1329:Agbl4 UTSW 4 110478455 splice site probably benign
R0277:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0323:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0690:Agbl4 UTSW 4 111657388 missense probably benign 0.35
R1086:Agbl4 UTSW 4 110478594 splice site probably benign
R1099:Agbl4 UTSW 4 110955663 critical splice donor site probably null
R1172:Agbl4 UTSW 4 111656318 splice site probably benign
R1480:Agbl4 UTSW 4 111566717 missense possibly damaging 0.56
R1508:Agbl4 UTSW 4 111656398 missense probably benign 0.10
R1564:Agbl4 UTSW 4 110955564 splice site probably null
R1610:Agbl4 UTSW 4 111657168 missense probably benign 0.00
R1989:Agbl4 UTSW 4 111566682 missense possibly damaging 0.92
R2327:Agbl4 UTSW 4 111526601 missense probably benign 0.00
R4780:Agbl4 UTSW 4 111657331 missense possibly damaging 0.73
R4806:Agbl4 UTSW 4 110955637 missense probably damaging 1.00
R4814:Agbl4 UTSW 4 111656368 missense possibly damaging 0.60
R5077:Agbl4 UTSW 4 111566742 missense probably benign 0.00
R5079:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R5091:Agbl4 UTSW 4 111119040 missense possibly damaging 0.79
R5124:Agbl4 UTSW 4 111656328 missense probably benign 0.21
R5297:Agbl4 UTSW 4 111566698 missense possibly damaging 0.92
R5645:Agbl4 UTSW 4 111657330 missense possibly damaging 0.53
R5996:Agbl4 UTSW 4 110955672 unclassified probably null
R6363:Agbl4 UTSW 4 111566785 intron probably benign
R6492:Agbl4 UTSW 4 111547272 missense probably damaging 1.00
R6617:Agbl4 UTSW 4 110580135 missense probably damaging 1.00
R6709:Agbl4 UTSW 4 111566782 intron probably benign
R6873:Agbl4 UTSW 4 111566659 missense possibly damaging 0.76
R7015:Agbl4 UTSW 4 110478500 missense probably damaging 1.00
R7105:Agbl4 UTSW 4 111566723 missense probably benign 0.06
R7143:Agbl4 UTSW 4 111617136 missense probably damaging 1.00
R7413:Agbl4 UTSW 4 111657298 missense probably benign 0.23
R7489:Agbl4 UTSW 4 111526658 missense probably damaging 1.00
R7583:Agbl4 UTSW 4 111118953 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGGTAGTGTGCCATAAGGATC -3'
(R):5'- TTAGAGCTGTCCGAGGATGTC -3'

Sequencing Primer
(F):5'- TAGTGTGCCATAAGGATCAAAGTG -3'
(R):5'- GAGGATGTCCCCCATACAATCTTC -3'
Posted On2014-06-30