Mutagenetix > Incidental Mutation

Incidental Mutation 'R1869:Arhgef5'

210524

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

039891-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1869 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43288682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1553 (I1553F)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: I1553F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I1553F

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182924
AA Change: I767F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 127 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921536K21Rik	A	G	11: 3,890,067	L110P	probably damaging	Het
6030458C11Rik	T	C	15: 12,817,907	D168G	probably damaging	Het
Abca13	A	T	11: 9,292,134	E1332D	probably benign	Het
Abhd11	A	G	5: 135,011,617	Y168C	probably damaging	Het
Actr5	A	C	2: 158,638,723	T554P	probably damaging	Het
Adamts16	A	G	13: 70,735,747	L1103P	probably damaging	Het
Adgrb3	A	T	1: 25,826,438	I108K	possibly damaging	Het
Agbl4	T	A	4: 111,566,629	M284K	possibly damaging	Het
Aoc3	T	A	11: 101,331,467	Y176*	probably null	Het
Aox1	A	G	1: 58,076,103	E749G	probably damaging	Het
Ap4b1	T	A	3: 103,820,868	Y399*	probably null	Het
Bag6	T	C	17: 35,142,826	V541A	probably benign	Het
Bdp1	A	C	13: 100,042,201	V1879G	probably damaging	Het
Bod1l	G	A	5: 41,833,675	S179F	possibly damaging	Het
Bsnd	C	T	4: 106,486,636	V158I	probably benign	Het
Cachd1	C	A	4: 100,983,390	H880N	probably damaging	Het
Ccdc27	T	C	4: 154,026,763		probably null	Het
Cd74	C	T	18: 60,810,412	P190S	probably benign	Het
Cep68	A	T	11: 20,240,217	L265Q	probably damaging	Het
Cfap70	G	A	14: 20,408,610	Q772*	probably null	Het
CK137956	T	A	4: 127,970,534	S101C	possibly damaging	Het
Clca3a2	G	A	3: 144,806,403	T524M	probably benign	Het
Cxcr6	T	C	9: 123,809,957	S15P	probably benign	Het
Cyfip2	T	A	11: 46,224,168	Y904F	probably benign	Het
D130040H23Rik	T	A	8: 69,302,702	I253N	probably benign	Het
Ddx56	C	T	11: 6,263,993	V389M	possibly damaging	Het
Dmp1	A	T	5: 104,212,076	D206V	probably damaging	Het
Dnah17	A	T	11: 118,047,189	C3350*	probably null	Het
Dpcr1	A	G	17: 35,638,413	L98P	possibly damaging	Het
Dst	A	T	1: 34,252,832	S877C	probably damaging	Het
Ermp1	A	G	19: 29,646,015	S192P	possibly damaging	Het
F13b	G	A	1: 139,510,934	D359N	probably benign	Het
Fam171a1	A	T	2: 3,226,152	Q769L	possibly damaging	Het
Fap	T	C	2: 62,528,727	R411G	probably damaging	Het
Fbn1	A	G	2: 125,352,027	V1340A	probably benign	Het
Fbxw19	T	C	9: 109,482,032	I370V	probably benign	Het
Foxi1	A	T	11: 34,207,937	N29K	possibly damaging	Het
Frem2	T	G	3: 53,535,196	D2640A	probably benign	Het
Fzd4	T	C	7: 89,407,246	V167A	probably benign	Het
Galnt3	T	C	2: 66,097,779	I258V	possibly damaging	Het
Galr2	T	C	11: 116,283,243	V233A	possibly damaging	Het
Gldc	G	T	19: 30,139,332	Q407K	probably benign	Het
Gm5346	A	T	8: 43,625,095	Y697*	probably null	Het
Gmcl1	T	C	6: 86,697,516	D460G	probably benign	Het
Gpr89	A	G	3: 96,875,659	I325T	probably benign	Het
Grap	T	A	11: 61,664,189	Y61N	possibly damaging	Het
Hbs1l	G	T	10: 21,358,406		probably null	Het
Hexb	T	A	13: 97,191,259	E134D	probably benign	Het
Hydin	T	A	8: 110,500,705	V1507D	possibly damaging	Het
Igkv8-16	C	A	6: 70,386,987	G17V	probably benign	Het
Kdm4a	T	A	4: 118,138,871	Q987L	probably null	Het
Krt76	A	G	15: 101,889,487		probably null	Het
Lap3	T	C	5: 45,503,387	S238P	probably benign	Het
Letm2	T	C	8: 25,581,713	D391G	probably damaging	Het
Lipn	A	G	19: 34,080,739	T287A	possibly damaging	Het
Macf1	T	C	4: 123,351,128	S466G	probably damaging	Het
Map3k5	C	A	10: 20,132,109	S1220*	probably null	Het
Map4	T	C	9: 110,034,964	V419A	probably benign	Het
Map4	T	A	9: 110,068,928	S754R	possibly damaging	Het
Mroh9	A	G	1: 163,026,513	S773P	probably damaging	Het
Mtus1	A	C	8: 41,076,230		probably null	Het
Muc1	C	T	3: 89,231,810	P533S	probably damaging	Het
Muc13	A	T	16: 33,804,600	I282F	probably damaging	Het
Myh14	T	A	7: 44,611,643	Q1816L	possibly damaging	Het
Nalcn	A	C	14: 123,594,553	V103G	possibly damaging	Het
Nlrp9c	G	A	7: 26,384,820	Q445*	probably null	Het
Olfml2b	A	G	1: 170,669,243	D481G	probably damaging	Het
Olfr1000	A	G	2: 85,608,500	S137P	probably benign	Het
Olfr1087	T	A	2: 86,690,391	I195F	probably damaging	Het
Olfr309	T	A	7: 86,306,667	I149F	possibly damaging	Het
Olfr703	T	G	7: 106,845,094	I161S	probably benign	Het
Olfr884	T	A	9: 38,048,202		probably null	Het
Pcdhb2	A	T	18: 37,297,355		probably null	Het
Pcdhb22	A	C	18: 37,519,147	T223P	probably damaging	Het
Pcdhga1	T	A	18: 37,840,090	N907K	probably damaging	Het
Pcnt	T	C	10: 76,379,906	E2347G	probably null	Het
Phax	T	A	18: 56,573,104	V22D	probably benign	Het
Pik3ca	T	C	3: 32,450,350	F667S	probably damaging	Het
Pkd1	T	C	17: 24,594,931	F4123S	probably damaging	Het
Pkhd1	A	G	1: 20,615,267		probably null	Het
Plcb1	G	A	2: 135,311,014	R368K	probably benign	Het
Prrc2a	G	T	17: 35,153,308	R1739S	possibly damaging	Het
Psg23	A	T	7: 18,614,618	M88K	probably benign	Het
Pstk	T	A	7: 131,387,797	Y354N	probably damaging	Het
Rab39	A	G	9: 53,705,931	I62T	possibly damaging	Het
Ranbp2	A	G	10: 58,492,561	I2800V	probably damaging	Het
Rasgrp1	T	C	2: 117,290,347	Y431C	probably damaging	Het
Rest	T	A	5: 77,268,362	V141E	possibly damaging	Het
Rnf167	T	A	11: 70,650,139	I197N	possibly damaging	Het
Rtn1	A	G	12: 72,308,168	S335P	probably damaging	Het
Ryr2	G	T	13: 11,662,075	R3297S	probably damaging	Het
S1pr3	A	C	13: 51,419,916	K378Q	probably benign	Het
Scgb1b24	T	C	7: 33,744,044	Y43H	probably damaging	Het
Sh3rf3	T	A	10: 59,083,513	M484K	probably damaging	Het
Shank1	A	T	7: 44,342,115	R69*	probably null	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Slc1a7	A	G	4: 108,008,364	T350A	probably damaging	Het
Slc25a54	T	A	3: 109,080,616	Y24*	probably null	Het
Slk	T	C	19: 47,625,452	F916L	probably damaging	Het
Snap91	T	A	9: 86,790,141		probably null	Het
Snrpb2	A	T	2: 143,065,186	R25S	possibly damaging	Het
Specc1l	T	C	10: 75,261,825	Y811H	probably damaging	Het
Sprr2h	A	G	3: 92,386,618		probably benign	Het
Sult2a5	A	T	7: 13,624,120	I26F	probably benign	Het
Syt13	C	T	2: 92,946,103	T245I	possibly damaging	Het
Tecrl	T	A	5: 83,354,859	T33S	probably benign	Het
Telo2	T	A	17: 25,114,994	D93V	probably benign	Het
Tet2	A	T	3: 133,481,441		probably null	Het
Tgm7	A	T	2: 121,101,089	C198S	probably damaging	Het
Ticrr	T	C	7: 79,679,135	F674S	probably damaging	Het
Tmem129	C	A	5: 33,654,499	C31F	probably damaging	Het
Tmem132a	T	A	19: 10,858,688	D826V	possibly damaging	Het
Tpd52	T	C	3: 8,953,802		probably null	Het
Trub2	A	G	2: 29,777,666	S321P	probably benign	Het
Ttc29	A	G	8: 78,282,385	T295A	probably benign	Het
Tubb1	G	A	2: 174,456,689	S89N	probably benign	Het
Ubap2	C	A	4: 41,233,617	G91V	probably damaging	Het
Ugt2b35	A	G	5: 87,001,288	N133D	probably damaging	Het
Usp34	A	G	11: 23,364,479	H807R	probably benign	Het
Vmn1r220	A	C	13: 23,184,287	C80G	probably damaging	Het
Vmn1r79	A	G	7: 12,176,647	E152G	probably benign	Het
Vmn2r28	T	C	7: 5,486,346	Y498C	probably benign	Het
Wif1	A	G	10: 121,084,919	I215M	probably benign	Het
Wnk1	T	C	6: 119,951,089	T1134A	probably damaging	Het
Zcchc11	T	A	4: 108,529,300	F1122L	probably damaging	Het
Zfp90	A	G	8: 106,419,123	H29R	probably benign	Het
Zfp972	A	G	2: 177,921,687		probably null	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTCCATTCAGCCTCAGGATGTC -3'
(R):5'- CAAGGGACTGAGCTCATCCTTG -3'

Sequencing Primer
(F):5'- CAGCCTCAGGATGTCGATTAATTTTC -3'
(R):5'- ATTTCAGAAGGCCAGGTTCC -3'

Posted On

2014-06-30