Incidental Mutation 'R1869:Ticrr'
ID 210539
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 039891-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R1869 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79328883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 674 (F674S)
Ref Sequence ENSEMBL: ENSMUSP00000146155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: F674S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: F674S

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: F674S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206622
AA Change: F674S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,840,067 (GRCm39) L110P probably damaging Het
6030458C11Rik T C 15: 12,817,993 (GRCm39) D168G probably damaging Het
Abca13 A T 11: 9,242,134 (GRCm39) E1332D probably benign Het
Abhd11 A G 5: 135,040,471 (GRCm39) Y168C probably damaging Het
Actr5 A C 2: 158,480,643 (GRCm39) T554P probably damaging Het
Adam34l A T 8: 44,078,132 (GRCm39) Y697* probably null Het
Adamts16 A G 13: 70,883,866 (GRCm39) L1103P probably damaging Het
Adgrb3 A T 1: 25,865,519 (GRCm39) I108K possibly damaging Het
Agbl4 T A 4: 111,423,826 (GRCm39) M284K possibly damaging Het
Aoc3 T A 11: 101,222,293 (GRCm39) Y176* probably null Het
Aox1 A G 1: 58,115,262 (GRCm39) E749G probably damaging Het
Ap4b1 T A 3: 103,728,184 (GRCm39) Y399* probably null Het
Arhgef5 A T 6: 43,265,616 (GRCm39) I1553F probably damaging Het
Bag6 T C 17: 35,361,802 (GRCm39) V541A probably benign Het
Bdp1 A C 13: 100,178,709 (GRCm39) V1879G probably damaging Het
Bod1l G A 5: 41,991,018 (GRCm39) S179F possibly damaging Het
Bsnd C T 4: 106,343,833 (GRCm39) V158I probably benign Het
Cachd1 C A 4: 100,840,587 (GRCm39) H880N probably damaging Het
Ccdc27 T C 4: 154,111,220 (GRCm39) probably null Het
Cd74 C T 18: 60,943,484 (GRCm39) P190S probably benign Het
Cep68 A T 11: 20,190,217 (GRCm39) L265Q probably damaging Het
Cfap70 G A 14: 20,458,678 (GRCm39) Q772* probably null Het
CK137956 T A 4: 127,864,327 (GRCm39) S101C possibly damaging Het
Clca3a2 G A 3: 144,512,164 (GRCm39) T524M probably benign Het
Cxcr6 T C 9: 123,639,022 (GRCm39) S15P probably benign Het
Cyfip2 T A 11: 46,114,995 (GRCm39) Y904F probably benign Het
D130040H23Rik T A 8: 69,755,354 (GRCm39) I253N probably benign Het
Ddx56 C T 11: 6,213,993 (GRCm39) V389M possibly damaging Het
Dmp1 A T 5: 104,359,942 (GRCm39) D206V probably damaging Het
Dnah17 A T 11: 117,938,015 (GRCm39) C3350* probably null Het
Dst A T 1: 34,291,913 (GRCm39) S877C probably damaging Het
Ermp1 A G 19: 29,623,415 (GRCm39) S192P possibly damaging Het
F13b G A 1: 139,438,672 (GRCm39) D359N probably benign Het
Fam171a1 A T 2: 3,227,189 (GRCm39) Q769L possibly damaging Het
Fap T C 2: 62,359,071 (GRCm39) R411G probably damaging Het
Fbn1 A G 2: 125,193,947 (GRCm39) V1340A probably benign Het
Fbxw19 T C 9: 109,311,100 (GRCm39) I370V probably benign Het
Foxi1 A T 11: 34,157,937 (GRCm39) N29K possibly damaging Het
Frem2 T G 3: 53,442,617 (GRCm39) D2640A probably benign Het
Fzd4 T C 7: 89,056,454 (GRCm39) V167A probably benign Het
Galnt3 T C 2: 65,928,123 (GRCm39) I258V possibly damaging Het
Galr2 T C 11: 116,174,069 (GRCm39) V233A possibly damaging Het
Gldc G T 19: 30,116,732 (GRCm39) Q407K probably benign Het
Gmcl1 T C 6: 86,674,498 (GRCm39) D460G probably benign Het
Gpr89 A G 3: 96,782,975 (GRCm39) I325T probably benign Het
Grap T A 11: 61,555,015 (GRCm39) Y61N possibly damaging Het
Hbs1l G T 10: 21,234,305 (GRCm39) probably null Het
Hexb T A 13: 97,327,767 (GRCm39) E134D probably benign Het
Hydin T A 8: 111,227,337 (GRCm39) V1507D possibly damaging Het
Igkv8-16 C A 6: 70,363,971 (GRCm39) G17V probably benign Het
Kdm4a T A 4: 117,996,068 (GRCm39) Q987L probably null Het
Krt76 A G 15: 101,797,922 (GRCm39) probably null Het
Lap3 T C 5: 45,660,729 (GRCm39) S238P probably benign Het
Letm2 T C 8: 26,071,729 (GRCm39) D391G probably damaging Het
Lipn A G 19: 34,058,139 (GRCm39) T287A possibly damaging Het
Macf1 T C 4: 123,244,921 (GRCm39) S466G probably damaging Het
Map3k5 C A 10: 20,007,855 (GRCm39) S1220* probably null Het
Map4 T A 9: 109,897,996 (GRCm39) S754R possibly damaging Het
Map4 T C 9: 109,864,032 (GRCm39) V419A probably benign Het
Mroh9 A G 1: 162,854,082 (GRCm39) S773P probably damaging Het
Mtus1 A C 8: 41,529,267 (GRCm39) probably null Het
Muc1 C T 3: 89,139,117 (GRCm39) P533S probably damaging Het
Muc13 A T 16: 33,624,970 (GRCm39) I282F probably damaging Het
Mucl3 A G 17: 35,949,305 (GRCm39) L98P possibly damaging Het
Myh14 T A 7: 44,261,067 (GRCm39) Q1816L possibly damaging Het
Nalcn A C 14: 123,831,965 (GRCm39) V103G possibly damaging Het
Nlrp9c G A 7: 26,084,245 (GRCm39) Q445* probably null Het
Olfml2b A G 1: 170,496,812 (GRCm39) D481G probably damaging Het
Or13g1 T A 7: 85,955,875 (GRCm39) I149F possibly damaging Het
Or2ag19 T G 7: 106,444,301 (GRCm39) I161S probably benign Het
Or5g23 A G 2: 85,438,844 (GRCm39) S137P probably benign Het
Or8b37 T A 9: 37,959,498 (GRCm39) probably null Het
Or8k3b T A 2: 86,520,735 (GRCm39) I195F probably damaging Het
Pcdhb2 A T 18: 37,430,408 (GRCm39) probably null Het
Pcdhb22 A C 18: 37,652,200 (GRCm39) T223P probably damaging Het
Pcdhga1 T A 18: 37,973,143 (GRCm39) N907K probably damaging Het
Pcnt T C 10: 76,215,740 (GRCm39) E2347G probably null Het
Phax T A 18: 56,706,176 (GRCm39) V22D probably benign Het
Pik3ca T C 3: 32,504,499 (GRCm39) F667S probably damaging Het
Pkd1 T C 17: 24,813,905 (GRCm39) F4123S probably damaging Het
Pkhd1 A G 1: 20,685,491 (GRCm39) probably null Het
Plcb1 G A 2: 135,152,934 (GRCm39) R368K probably benign Het
Prrc2a G T 17: 35,372,284 (GRCm39) R1739S possibly damaging Het
Psg23 A T 7: 18,348,543 (GRCm39) M88K probably benign Het
Pstk T A 7: 130,989,526 (GRCm39) Y354N probably damaging Het
Rab39 A G 9: 53,617,231 (GRCm39) I62T possibly damaging Het
Ranbp2 A G 10: 58,328,383 (GRCm39) I2800V probably damaging Het
Rasgrp1 T C 2: 117,120,828 (GRCm39) Y431C probably damaging Het
Rest T A 5: 77,416,209 (GRCm39) V141E possibly damaging Het
Rnf167 T A 11: 70,540,965 (GRCm39) I197N possibly damaging Het
Rtn1 A G 12: 72,354,942 (GRCm39) S335P probably damaging Het
Ryr2 G T 13: 11,676,961 (GRCm39) R3297S probably damaging Het
S1pr3 A C 13: 51,573,952 (GRCm39) K378Q probably benign Het
Scgb1b24 T C 7: 33,443,469 (GRCm39) Y43H probably damaging Het
Sh3rf3 T A 10: 58,919,335 (GRCm39) M484K probably damaging Het
Shank1 A T 7: 43,991,539 (GRCm39) R69* probably null Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Slc1a7 A G 4: 107,865,561 (GRCm39) T350A probably damaging Het
Slc25a54 T A 3: 108,987,932 (GRCm39) Y24* probably null Het
Slk T C 19: 47,613,891 (GRCm39) F916L probably damaging Het
Snap91 T A 9: 86,672,194 (GRCm39) probably null Het
Snrpb2 A T 2: 142,907,106 (GRCm39) R25S possibly damaging Het
Specc1l T C 10: 75,097,659 (GRCm39) Y811H probably damaging Het
Sprr2h A G 3: 92,293,925 (GRCm39) probably benign Het
Sult2a5 A T 7: 13,358,045 (GRCm39) I26F probably benign Het
Syt13 C T 2: 92,776,448 (GRCm39) T245I possibly damaging Het
Tecrl T A 5: 83,502,706 (GRCm39) T33S probably benign Het
Telo2 T A 17: 25,333,968 (GRCm39) D93V probably benign Het
Tet2 A T 3: 133,187,202 (GRCm39) probably null Het
Tgm7 A T 2: 120,931,570 (GRCm39) C198S probably damaging Het
Tmem129 C A 5: 33,811,843 (GRCm39) C31F probably damaging Het
Tmem132a T A 19: 10,836,052 (GRCm39) D826V possibly damaging Het
Tpd52 T C 3: 9,018,862 (GRCm39) probably null Het
Trub2 A G 2: 29,667,678 (GRCm39) S321P probably benign Het
Ttc29 A G 8: 79,009,014 (GRCm39) T295A probably benign Het
Tubb1 G A 2: 174,298,482 (GRCm39) S89N probably benign Het
Tut4 T A 4: 108,386,497 (GRCm39) F1122L probably damaging Het
Ubap2 C A 4: 41,233,617 (GRCm39) G91V probably damaging Het
Ugt2b35 A G 5: 87,149,147 (GRCm39) N133D probably damaging Het
Usp34 A G 11: 23,314,479 (GRCm39) H807R probably benign Het
Vmn1r220 A C 13: 23,368,457 (GRCm39) C80G probably damaging Het
Vmn1r79 A G 7: 11,910,574 (GRCm39) E152G probably benign Het
Vmn2r28 T C 7: 5,489,345 (GRCm39) Y498C probably benign Het
Wif1 A G 10: 120,920,824 (GRCm39) I215M probably benign Het
Wnk1 T C 6: 119,928,050 (GRCm39) T1134A probably damaging Het
Zfp90 A G 8: 107,145,755 (GRCm39) H29R probably benign Het
Zfp972 A G 2: 177,563,480 (GRCm39) probably null Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGTCCCCTTACAGGATACATGG -3'
(R):5'- AATTGTACCAATCCTCTACTCAGC -3'

Sequencing Primer
(F):5'- CCCCTTACAGGATACATGGAGTTG -3'
(R):5'- GATTTTGAGCCACCATGTAGC -3'
Posted On 2014-06-30