Incidental Mutation 'R1869:Hydin'
ID 210551
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene Name HYDIN, axonemal central pair apparatus protein
Synonyms 1700034M11Rik, 4930545D19Rik, hy3, hyrh, hy-3
MMRRC Submission 039891-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.757) question?
Stock # R1869 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 110993609-111336885 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111227337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1507 (V1507D)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000043141
AA Change: V1507D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: V1507D

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197243
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,840,067 (GRCm39) L110P probably damaging Het
6030458C11Rik T C 15: 12,817,993 (GRCm39) D168G probably damaging Het
Abca13 A T 11: 9,242,134 (GRCm39) E1332D probably benign Het
Abhd11 A G 5: 135,040,471 (GRCm39) Y168C probably damaging Het
Actr5 A C 2: 158,480,643 (GRCm39) T554P probably damaging Het
Adam34l A T 8: 44,078,132 (GRCm39) Y697* probably null Het
Adamts16 A G 13: 70,883,866 (GRCm39) L1103P probably damaging Het
Adgrb3 A T 1: 25,865,519 (GRCm39) I108K possibly damaging Het
Agbl4 T A 4: 111,423,826 (GRCm39) M284K possibly damaging Het
Aoc3 T A 11: 101,222,293 (GRCm39) Y176* probably null Het
Aox1 A G 1: 58,115,262 (GRCm39) E749G probably damaging Het
Ap4b1 T A 3: 103,728,184 (GRCm39) Y399* probably null Het
Arhgef5 A T 6: 43,265,616 (GRCm39) I1553F probably damaging Het
Bag6 T C 17: 35,361,802 (GRCm39) V541A probably benign Het
Bdp1 A C 13: 100,178,709 (GRCm39) V1879G probably damaging Het
Bod1l G A 5: 41,991,018 (GRCm39) S179F possibly damaging Het
Bsnd C T 4: 106,343,833 (GRCm39) V158I probably benign Het
Cachd1 C A 4: 100,840,587 (GRCm39) H880N probably damaging Het
Ccdc27 T C 4: 154,111,220 (GRCm39) probably null Het
Cd74 C T 18: 60,943,484 (GRCm39) P190S probably benign Het
Cep68 A T 11: 20,190,217 (GRCm39) L265Q probably damaging Het
Cfap70 G A 14: 20,458,678 (GRCm39) Q772* probably null Het
CK137956 T A 4: 127,864,327 (GRCm39) S101C possibly damaging Het
Clca3a2 G A 3: 144,512,164 (GRCm39) T524M probably benign Het
Cxcr6 T C 9: 123,639,022 (GRCm39) S15P probably benign Het
Cyfip2 T A 11: 46,114,995 (GRCm39) Y904F probably benign Het
D130040H23Rik T A 8: 69,755,354 (GRCm39) I253N probably benign Het
Ddx56 C T 11: 6,213,993 (GRCm39) V389M possibly damaging Het
Dmp1 A T 5: 104,359,942 (GRCm39) D206V probably damaging Het
Dnah17 A T 11: 117,938,015 (GRCm39) C3350* probably null Het
Dst A T 1: 34,291,913 (GRCm39) S877C probably damaging Het
Ermp1 A G 19: 29,623,415 (GRCm39) S192P possibly damaging Het
F13b G A 1: 139,438,672 (GRCm39) D359N probably benign Het
Fam171a1 A T 2: 3,227,189 (GRCm39) Q769L possibly damaging Het
Fap T C 2: 62,359,071 (GRCm39) R411G probably damaging Het
Fbn1 A G 2: 125,193,947 (GRCm39) V1340A probably benign Het
Fbxw19 T C 9: 109,311,100 (GRCm39) I370V probably benign Het
Foxi1 A T 11: 34,157,937 (GRCm39) N29K possibly damaging Het
Frem2 T G 3: 53,442,617 (GRCm39) D2640A probably benign Het
Fzd4 T C 7: 89,056,454 (GRCm39) V167A probably benign Het
Galnt3 T C 2: 65,928,123 (GRCm39) I258V possibly damaging Het
Galr2 T C 11: 116,174,069 (GRCm39) V233A possibly damaging Het
Gldc G T 19: 30,116,732 (GRCm39) Q407K probably benign Het
Gmcl1 T C 6: 86,674,498 (GRCm39) D460G probably benign Het
Gpr89 A G 3: 96,782,975 (GRCm39) I325T probably benign Het
Grap T A 11: 61,555,015 (GRCm39) Y61N possibly damaging Het
Hbs1l G T 10: 21,234,305 (GRCm39) probably null Het
Hexb T A 13: 97,327,767 (GRCm39) E134D probably benign Het
Igkv8-16 C A 6: 70,363,971 (GRCm39) G17V probably benign Het
Kdm4a T A 4: 117,996,068 (GRCm39) Q987L probably null Het
Krt76 A G 15: 101,797,922 (GRCm39) probably null Het
Lap3 T C 5: 45,660,729 (GRCm39) S238P probably benign Het
Letm2 T C 8: 26,071,729 (GRCm39) D391G probably damaging Het
Lipn A G 19: 34,058,139 (GRCm39) T287A possibly damaging Het
Macf1 T C 4: 123,244,921 (GRCm39) S466G probably damaging Het
Map3k5 C A 10: 20,007,855 (GRCm39) S1220* probably null Het
Map4 T A 9: 109,897,996 (GRCm39) S754R possibly damaging Het
Map4 T C 9: 109,864,032 (GRCm39) V419A probably benign Het
Mroh9 A G 1: 162,854,082 (GRCm39) S773P probably damaging Het
Mtus1 A C 8: 41,529,267 (GRCm39) probably null Het
Muc1 C T 3: 89,139,117 (GRCm39) P533S probably damaging Het
Muc13 A T 16: 33,624,970 (GRCm39) I282F probably damaging Het
Mucl3 A G 17: 35,949,305 (GRCm39) L98P possibly damaging Het
Myh14 T A 7: 44,261,067 (GRCm39) Q1816L possibly damaging Het
Nalcn A C 14: 123,831,965 (GRCm39) V103G possibly damaging Het
Nlrp9c G A 7: 26,084,245 (GRCm39) Q445* probably null Het
Olfml2b A G 1: 170,496,812 (GRCm39) D481G probably damaging Het
Or13g1 T A 7: 85,955,875 (GRCm39) I149F possibly damaging Het
Or2ag19 T G 7: 106,444,301 (GRCm39) I161S probably benign Het
Or5g23 A G 2: 85,438,844 (GRCm39) S137P probably benign Het
Or8b37 T A 9: 37,959,498 (GRCm39) probably null Het
Or8k3b T A 2: 86,520,735 (GRCm39) I195F probably damaging Het
Pcdhb2 A T 18: 37,430,408 (GRCm39) probably null Het
Pcdhb22 A C 18: 37,652,200 (GRCm39) T223P probably damaging Het
Pcdhga1 T A 18: 37,973,143 (GRCm39) N907K probably damaging Het
Pcnt T C 10: 76,215,740 (GRCm39) E2347G probably null Het
Phax T A 18: 56,706,176 (GRCm39) V22D probably benign Het
Pik3ca T C 3: 32,504,499 (GRCm39) F667S probably damaging Het
Pkd1 T C 17: 24,813,905 (GRCm39) F4123S probably damaging Het
Pkhd1 A G 1: 20,685,491 (GRCm39) probably null Het
Plcb1 G A 2: 135,152,934 (GRCm39) R368K probably benign Het
Prrc2a G T 17: 35,372,284 (GRCm39) R1739S possibly damaging Het
Psg23 A T 7: 18,348,543 (GRCm39) M88K probably benign Het
Pstk T A 7: 130,989,526 (GRCm39) Y354N probably damaging Het
Rab39 A G 9: 53,617,231 (GRCm39) I62T possibly damaging Het
Ranbp2 A G 10: 58,328,383 (GRCm39) I2800V probably damaging Het
Rasgrp1 T C 2: 117,120,828 (GRCm39) Y431C probably damaging Het
Rest T A 5: 77,416,209 (GRCm39) V141E possibly damaging Het
Rnf167 T A 11: 70,540,965 (GRCm39) I197N possibly damaging Het
Rtn1 A G 12: 72,354,942 (GRCm39) S335P probably damaging Het
Ryr2 G T 13: 11,676,961 (GRCm39) R3297S probably damaging Het
S1pr3 A C 13: 51,573,952 (GRCm39) K378Q probably benign Het
Scgb1b24 T C 7: 33,443,469 (GRCm39) Y43H probably damaging Het
Sh3rf3 T A 10: 58,919,335 (GRCm39) M484K probably damaging Het
Shank1 A T 7: 43,991,539 (GRCm39) R69* probably null Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Slc1a7 A G 4: 107,865,561 (GRCm39) T350A probably damaging Het
Slc25a54 T A 3: 108,987,932 (GRCm39) Y24* probably null Het
Slk T C 19: 47,613,891 (GRCm39) F916L probably damaging Het
Snap91 T A 9: 86,672,194 (GRCm39) probably null Het
Snrpb2 A T 2: 142,907,106 (GRCm39) R25S possibly damaging Het
Specc1l T C 10: 75,097,659 (GRCm39) Y811H probably damaging Het
Sprr2h A G 3: 92,293,925 (GRCm39) probably benign Het
Sult2a5 A T 7: 13,358,045 (GRCm39) I26F probably benign Het
Syt13 C T 2: 92,776,448 (GRCm39) T245I possibly damaging Het
Tecrl T A 5: 83,502,706 (GRCm39) T33S probably benign Het
Telo2 T A 17: 25,333,968 (GRCm39) D93V probably benign Het
Tet2 A T 3: 133,187,202 (GRCm39) probably null Het
Tgm7 A T 2: 120,931,570 (GRCm39) C198S probably damaging Het
Ticrr T C 7: 79,328,883 (GRCm39) F674S probably damaging Het
Tmem129 C A 5: 33,811,843 (GRCm39) C31F probably damaging Het
Tmem132a T A 19: 10,836,052 (GRCm39) D826V possibly damaging Het
Tpd52 T C 3: 9,018,862 (GRCm39) probably null Het
Trub2 A G 2: 29,667,678 (GRCm39) S321P probably benign Het
Ttc29 A G 8: 79,009,014 (GRCm39) T295A probably benign Het
Tubb1 G A 2: 174,298,482 (GRCm39) S89N probably benign Het
Tut4 T A 4: 108,386,497 (GRCm39) F1122L probably damaging Het
Ubap2 C A 4: 41,233,617 (GRCm39) G91V probably damaging Het
Ugt2b35 A G 5: 87,149,147 (GRCm39) N133D probably damaging Het
Usp34 A G 11: 23,314,479 (GRCm39) H807R probably benign Het
Vmn1r220 A C 13: 23,368,457 (GRCm39) C80G probably damaging Het
Vmn1r79 A G 7: 11,910,574 (GRCm39) E152G probably benign Het
Vmn2r28 T C 7: 5,489,345 (GRCm39) Y498C probably benign Het
Wif1 A G 10: 120,920,824 (GRCm39) I215M probably benign Het
Wnk1 T C 6: 119,928,050 (GRCm39) T1134A probably damaging Het
Zfp90 A G 8: 107,145,755 (GRCm39) H29R probably benign Het
Zfp972 A G 2: 177,563,480 (GRCm39) probably null Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 111,296,434 (GRCm39) missense possibly damaging 0.69
IGL00432:Hydin APN 8 111,327,884 (GRCm39) missense probably damaging 0.98
IGL01025:Hydin APN 8 111,053,033 (GRCm39) missense probably benign 0.38
IGL01140:Hydin APN 8 111,124,694 (GRCm39) missense probably benign 0.14
IGL01317:Hydin APN 8 111,053,078 (GRCm39) missense probably damaging 0.98
IGL01473:Hydin APN 8 111,038,792 (GRCm39) missense probably benign 0.08
IGL01473:Hydin APN 8 111,081,585 (GRCm39) missense probably damaging 1.00
IGL01610:Hydin APN 8 111,284,345 (GRCm39) missense probably benign 0.00
IGL01685:Hydin APN 8 111,081,665 (GRCm39) nonsense probably null
IGL01734:Hydin APN 8 111,217,421 (GRCm39) nonsense probably null
IGL01743:Hydin APN 8 111,319,408 (GRCm39) missense possibly damaging 0.94
IGL01829:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL01919:Hydin APN 8 111,245,806 (GRCm39) missense possibly damaging 0.89
IGL01946:Hydin APN 8 111,217,350 (GRCm39) missense possibly damaging 0.91
IGL01983:Hydin APN 8 111,241,527 (GRCm39) missense probably benign 0.02
IGL02122:Hydin APN 8 111,221,047 (GRCm39) missense possibly damaging 0.86
IGL02140:Hydin APN 8 111,293,570 (GRCm39) missense probably benign
IGL02158:Hydin APN 8 111,336,598 (GRCm39) missense possibly damaging 0.89
IGL02167:Hydin APN 8 111,145,055 (GRCm39) missense possibly damaging 0.96
IGL02171:Hydin APN 8 111,178,590 (GRCm39) nonsense probably null
IGL02185:Hydin APN 8 111,233,108 (GRCm39) missense possibly damaging 0.86
IGL02517:Hydin APN 8 111,293,604 (GRCm39) missense probably benign 0.01
IGL02639:Hydin APN 8 111,265,081 (GRCm39) missense probably benign 0.01
IGL02644:Hydin APN 8 111,265,100 (GRCm39) missense probably damaging 1.00
IGL02652:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL02658:Hydin APN 8 111,139,908 (GRCm39) missense possibly damaging 0.86
IGL02706:Hydin APN 8 111,137,198 (GRCm39) missense probably damaging 0.99
IGL02892:Hydin APN 8 111,325,591 (GRCm39) missense possibly damaging 0.89
IGL02947:Hydin APN 8 111,145,094 (GRCm39) missense probably damaging 0.96
IGL03136:Hydin APN 8 111,145,156 (GRCm39) missense probably benign 0.22
IGL03248:Hydin APN 8 111,321,921 (GRCm39) missense probably damaging 0.97
IGL03251:Hydin APN 8 111,217,228 (GRCm39) missense probably damaging 1.00
IGL03350:Hydin APN 8 111,038,856 (GRCm39) missense possibly damaging 0.86
IGL03366:Hydin APN 8 110,993,995 (GRCm39) missense unknown
IGL03404:Hydin APN 8 111,296,409 (GRCm39) missense probably benign 0.06
Franz_joseph UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
jahreszeiten UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
maria UTSW 8 111,235,759 (GRCm39) splice site probably benign
schoepfung UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
surprise UTSW 8 111,254,648 (GRCm39) missense probably benign
teresa UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
BB001:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB004:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
BB011:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB014:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
P0005:Hydin UTSW 8 111,220,921 (GRCm39) critical splice acceptor site probably null
R0099:Hydin UTSW 8 111,316,193 (GRCm39) missense probably damaging 1.00
R0125:Hydin UTSW 8 111,189,163 (GRCm39) missense probably benign 0.12
R0157:Hydin UTSW 8 111,026,642 (GRCm39) missense possibly damaging 0.86
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0255:Hydin UTSW 8 111,291,650 (GRCm39) missense probably benign 0.00
R0352:Hydin UTSW 8 111,296,533 (GRCm39) critical splice donor site probably null
R0379:Hydin UTSW 8 111,235,759 (GRCm39) splice site probably benign
R0468:Hydin UTSW 8 111,139,855 (GRCm39) missense possibly damaging 0.96
R0477:Hydin UTSW 8 111,145,130 (GRCm39) missense probably damaging 1.00
R0479:Hydin UTSW 8 111,325,720 (GRCm39) missense probably damaging 1.00
R0539:Hydin UTSW 8 111,249,704 (GRCm39) missense probably benign
R0550:Hydin UTSW 8 111,314,407 (GRCm39) missense probably benign 0.01
R0571:Hydin UTSW 8 111,240,735 (GRCm39) splice site probably null
R0606:Hydin UTSW 8 111,276,430 (GRCm39) splice site probably benign
R0789:Hydin UTSW 8 111,293,603 (GRCm39) missense possibly damaging 0.53
R0849:Hydin UTSW 8 111,325,616 (GRCm39) missense probably damaging 1.00
R0946:Hydin UTSW 8 111,257,685 (GRCm39) missense probably benign 0.25
R1201:Hydin UTSW 8 111,296,487 (GRCm39) missense probably benign 0.01
R1375:Hydin UTSW 8 111,232,854 (GRCm39) critical splice donor site probably null
R1385:Hydin UTSW 8 111,249,836 (GRCm39) missense probably benign 0.40
R1411:Hydin UTSW 8 111,301,663 (GRCm39) missense probably benign 0.04
R1437:Hydin UTSW 8 111,308,617 (GRCm39) nonsense probably null
R1447:Hydin UTSW 8 111,249,798 (GRCm39) missense probably damaging 1.00
R1448:Hydin UTSW 8 111,173,217 (GRCm39) missense probably benign 0.27
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1523:Hydin UTSW 8 111,259,903 (GRCm39) missense probably benign 0.05
R1544:Hydin UTSW 8 111,301,486 (GRCm39) missense probably benign 0.30
R1581:Hydin UTSW 8 111,137,092 (GRCm39) missense probably benign
R1584:Hydin UTSW 8 111,307,447 (GRCm39) missense probably benign 0.27
R1598:Hydin UTSW 8 111,137,306 (GRCm39) missense possibly damaging 0.96
R1633:Hydin UTSW 8 111,233,614 (GRCm39) missense probably benign 0.10
R1777:Hydin UTSW 8 111,316,203 (GRCm39) missense probably benign 0.14
R1817:Hydin UTSW 8 111,259,459 (GRCm39) missense probably benign 0.00
R1828:Hydin UTSW 8 111,237,526 (GRCm39) missense probably benign 0.03
R1837:Hydin UTSW 8 111,296,257 (GRCm39) missense probably benign 0.20
R1848:Hydin UTSW 8 111,296,440 (GRCm39) missense probably benign 0.19
R1909:Hydin UTSW 8 111,314,404 (GRCm39) missense probably damaging 1.00
R1928:Hydin UTSW 8 111,229,579 (GRCm39) missense possibly damaging 0.93
R1950:Hydin UTSW 8 111,336,619 (GRCm39) missense possibly damaging 0.64
R2095:Hydin UTSW 8 111,189,289 (GRCm39) missense probably damaging 0.96
R2172:Hydin UTSW 8 111,308,681 (GRCm39) missense probably benign 0.42
R2217:Hydin UTSW 8 111,145,138 (GRCm39) missense probably benign
R2248:Hydin UTSW 8 111,304,835 (GRCm39) missense probably benign 0.09
R2272:Hydin UTSW 8 111,035,764 (GRCm39) missense probably benign 0.01
R2294:Hydin UTSW 8 111,026,591 (GRCm39) missense probably damaging 0.99
R2315:Hydin UTSW 8 111,124,676 (GRCm39) missense probably benign 0.01
R2330:Hydin UTSW 8 111,291,641 (GRCm39) missense probably benign 0.01
R2374:Hydin UTSW 8 111,291,780 (GRCm39) missense probably damaging 1.00
R2446:Hydin UTSW 8 111,314,347 (GRCm39) missense possibly damaging 0.82
R2484:Hydin UTSW 8 111,239,747 (GRCm39) missense possibly damaging 0.76
R2698:Hydin UTSW 8 111,336,561 (GRCm39) missense possibly damaging 0.70
R2843:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2844:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2846:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2882:Hydin UTSW 8 111,293,555 (GRCm39) missense possibly damaging 0.92
R2937:Hydin UTSW 8 111,130,927 (GRCm39) missense possibly damaging 0.88
R3031:Hydin UTSW 8 111,329,848 (GRCm39) missense possibly damaging 0.83
R3038:Hydin UTSW 8 111,309,321 (GRCm39) missense probably damaging 1.00
R3121:Hydin UTSW 8 111,233,138 (GRCm39) missense probably benign
R3157:Hydin UTSW 8 110,994,005 (GRCm39) missense unknown
R3547:Hydin UTSW 8 111,308,699 (GRCm39) missense possibly damaging 0.85
R3696:Hydin UTSW 8 111,329,911 (GRCm39) missense probably damaging 1.00
R3850:Hydin UTSW 8 111,290,561 (GRCm39) missense probably damaging 0.99
R3896:Hydin UTSW 8 111,235,711 (GRCm39) missense possibly damaging 0.93
R3983:Hydin UTSW 8 111,118,957 (GRCm39) missense probably damaging 1.00
R4031:Hydin UTSW 8 111,336,679 (GRCm39) missense probably benign 0.30
R4072:Hydin UTSW 8 111,231,888 (GRCm39) missense possibly damaging 0.68
R4095:Hydin UTSW 8 111,268,179 (GRCm39) missense probably damaging 0.98
R4176:Hydin UTSW 8 111,320,452 (GRCm39) missense probably benign 0.00
R4213:Hydin UTSW 8 111,183,139 (GRCm39) missense possibly damaging 0.91
R4412:Hydin UTSW 8 111,142,368 (GRCm39) missense probably damaging 0.99
R4471:Hydin UTSW 8 111,313,764 (GRCm39) missense probably damaging 1.00
R4474:Hydin UTSW 8 111,290,497 (GRCm39) missense probably benign 0.11
R4495:Hydin UTSW 8 111,322,034 (GRCm39) missense probably damaging 0.99
R4508:Hydin UTSW 8 111,245,886 (GRCm39) missense possibly damaging 0.91
R4578:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R4583:Hydin UTSW 8 111,321,857 (GRCm39) missense probably benign 0.36
R4600:Hydin UTSW 8 111,293,582 (GRCm39) missense probably benign 0.04
R4681:Hydin UTSW 8 111,233,103 (GRCm39) missense possibly damaging 0.85
R4685:Hydin UTSW 8 111,189,154 (GRCm39) missense probably damaging 0.99
R4689:Hydin UTSW 8 111,322,046 (GRCm39) missense probably benign 0.18
R4735:Hydin UTSW 8 111,282,264 (GRCm39) critical splice donor site probably null
R4736:Hydin UTSW 8 111,249,840 (GRCm39) missense probably benign 0.02
R4740:Hydin UTSW 8 111,173,071 (GRCm39) missense probably benign 0.06
R4771:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R4777:Hydin UTSW 8 111,137,096 (GRCm39) missense probably damaging 0.98
R4859:Hydin UTSW 8 111,233,126 (GRCm39) missense possibly damaging 0.93
R4911:Hydin UTSW 8 111,322,070 (GRCm39) missense probably benign 0.01
R4964:Hydin UTSW 8 111,217,305 (GRCm39) missense possibly damaging 0.86
R4965:Hydin UTSW 8 111,124,727 (GRCm39) missense probably benign
R4989:Hydin UTSW 8 111,290,554 (GRCm39) missense possibly damaging 0.84
R4995:Hydin UTSW 8 111,296,274 (GRCm39) missense probably damaging 0.97
R5059:Hydin UTSW 8 111,232,401 (GRCm39) missense probably damaging 0.96
R5071:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5073:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5092:Hydin UTSW 8 111,309,300 (GRCm39) missense probably benign 0.16
R5156:Hydin UTSW 8 111,336,333 (GRCm39) missense probably benign 0.00
R5166:Hydin UTSW 8 111,249,774 (GRCm39) missense possibly damaging 0.89
R5189:Hydin UTSW 8 111,139,843 (GRCm39) critical splice acceptor site probably null
R5243:Hydin UTSW 8 111,232,380 (GRCm39) missense possibly damaging 0.92
R5244:Hydin UTSW 8 111,259,451 (GRCm39) missense possibly damaging 0.77
R5256:Hydin UTSW 8 111,313,855 (GRCm39) missense possibly damaging 0.92
R5266:Hydin UTSW 8 111,061,416 (GRCm39) missense possibly damaging 0.87
R5283:Hydin UTSW 8 111,178,612 (GRCm39) missense possibly damaging 0.96
R5343:Hydin UTSW 8 111,212,051 (GRCm39) missense probably benign 0.40
R5359:Hydin UTSW 8 111,265,004 (GRCm39) missense probably benign 0.00
R5390:Hydin UTSW 8 111,322,099 (GRCm39) missense probably benign
R5394:Hydin UTSW 8 111,266,474 (GRCm39) splice site probably null
R5441:Hydin UTSW 8 111,291,741 (GRCm39) missense possibly damaging 0.72
R5461:Hydin UTSW 8 111,245,863 (GRCm39) missense probably damaging 0.96
R5662:Hydin UTSW 8 111,307,341 (GRCm39) missense probably benign 0.02
R5695:Hydin UTSW 8 111,261,915 (GRCm39) missense probably benign 0.35
R5732:Hydin UTSW 8 111,178,690 (GRCm39) missense probably benign 0.03
R5774:Hydin UTSW 8 111,298,547 (GRCm39) nonsense probably null
R5780:Hydin UTSW 8 111,312,712 (GRCm39) missense probably damaging 1.00
R5787:Hydin UTSW 8 111,052,985 (GRCm39) missense probably damaging 0.99
R5802:Hydin UTSW 8 111,178,692 (GRCm39) missense possibly damaging 0.86
R5841:Hydin UTSW 8 111,259,846 (GRCm39) missense possibly damaging 0.76
R5856:Hydin UTSW 8 111,268,474 (GRCm39) missense probably damaging 0.99
R5893:Hydin UTSW 8 111,217,308 (GRCm39) missense probably benign 0.12
R5963:Hydin UTSW 8 111,220,926 (GRCm39) missense possibly damaging 0.93
R6008:Hydin UTSW 8 111,325,717 (GRCm39) missense probably benign 0.02
R6019:Hydin UTSW 8 111,293,252 (GRCm39) missense probably benign
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6133:Hydin UTSW 8 111,327,908 (GRCm39) missense probably benign 0.00
R6135:Hydin UTSW 8 111,189,292 (GRCm39) missense possibly damaging 0.85
R6157:Hydin UTSW 8 111,254,648 (GRCm39) missense probably benign
R6209:Hydin UTSW 8 111,320,434 (GRCm39) missense probably benign 0.05
R6238:Hydin UTSW 8 111,118,743 (GRCm39) splice site probably null
R6293:Hydin UTSW 8 111,324,543 (GRCm39) missense possibly damaging 0.83
R6340:Hydin UTSW 8 111,081,574 (GRCm39) splice site probably null
R6349:Hydin UTSW 8 111,145,091 (GRCm39) nonsense probably null
R6357:Hydin UTSW 8 111,268,289 (GRCm39) missense possibly damaging 0.86
R6385:Hydin UTSW 8 111,038,856 (GRCm39) missense possibly damaging 0.86
R6396:Hydin UTSW 8 111,233,521 (GRCm39) missense probably damaging 0.96
R6466:Hydin UTSW 8 111,233,600 (GRCm39) missense possibly damaging 0.85
R6648:Hydin UTSW 8 111,252,299 (GRCm39) splice site probably null
R6671:Hydin UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
R6695:Hydin UTSW 8 111,053,092 (GRCm39) missense probably benign 0.05
R6800:Hydin UTSW 8 111,324,603 (GRCm39) missense probably benign 0.09
R6841:Hydin UTSW 8 111,265,007 (GRCm39) missense probably benign 0.09
R6867:Hydin UTSW 8 111,266,434 (GRCm39) missense probably benign 0.08
R6889:Hydin UTSW 8 111,259,488 (GRCm39) missense possibly damaging 0.79
R6895:Hydin UTSW 8 111,038,883 (GRCm39) missense probably benign 0.00
R6940:Hydin UTSW 8 111,217,243 (GRCm39) missense probably damaging 1.00
R6951:Hydin UTSW 8 111,124,757 (GRCm39) missense probably benign
R6980:Hydin UTSW 8 111,139,916 (GRCm39) missense possibly damaging 0.91
R6981:Hydin UTSW 8 111,257,704 (GRCm39) missense possibly damaging 0.89
R7061:Hydin UTSW 8 111,329,920 (GRCm39) missense possibly damaging 0.90
R7085:Hydin UTSW 8 111,329,962 (GRCm39) missense probably benign 0.03
R7086:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R7110:Hydin UTSW 8 111,081,583 (GRCm39) critical splice acceptor site probably null
R7158:Hydin UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
R7163:Hydin UTSW 8 111,329,968 (GRCm39) missense probably benign 0.25
R7209:Hydin UTSW 8 111,216,424 (GRCm39) nonsense probably null
R7244:Hydin UTSW 8 111,276,307 (GRCm39) missense probably damaging 0.98
R7347:Hydin UTSW 8 111,326,994 (GRCm39) missense probably benign 0.06
R7349:Hydin UTSW 8 111,124,803 (GRCm39) splice site probably null
R7359:Hydin UTSW 8 111,232,733 (GRCm39) missense probably damaging 0.98
R7365:Hydin UTSW 8 111,327,905 (GRCm39) missense probably damaging 1.00
R7365:Hydin UTSW 8 111,284,294 (GRCm39) missense probably damaging 0.99
R7436:Hydin UTSW 8 111,310,546 (GRCm39) missense probably damaging 0.96
R7528:Hydin UTSW 8 111,107,204 (GRCm39) nonsense probably null
R7544:Hydin UTSW 8 111,316,157 (GRCm39) missense probably benign 0.35
R7625:Hydin UTSW 8 111,268,476 (GRCm39) missense probably benign 0.01
R7713:Hydin UTSW 8 111,320,444 (GRCm39) missense possibly damaging 0.69
R7763:Hydin UTSW 8 111,232,475 (GRCm39) missense possibly damaging 0.92
R7771:Hydin UTSW 8 111,291,717 (GRCm39) missense probably damaging 0.97
R7794:Hydin UTSW 8 111,235,715 (GRCm39) missense probably damaging 1.00
R7833:Hydin UTSW 8 111,316,092 (GRCm39) missense probably damaging 0.99
R7894:Hydin UTSW 8 111,239,642 (GRCm39) missense possibly damaging 0.88
R7899:Hydin UTSW 8 111,314,380 (GRCm39) missense probably benign 0.00
R7908:Hydin UTSW 8 111,237,499 (GRCm39) missense probably benign 0.01
R7912:Hydin UTSW 8 111,282,239 (GRCm39) missense possibly damaging 0.68
R7919:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R7924:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
R7927:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
R7970:Hydin UTSW 8 111,035,723 (GRCm39) missense probably damaging 0.99
R7993:Hydin UTSW 8 111,306,264 (GRCm39) missense probably benign
R8011:Hydin UTSW 8 111,310,541 (GRCm39) missense probably damaging 1.00
R8041:Hydin UTSW 8 111,301,626 (GRCm39) missense probably benign 0.02
R8080:Hydin UTSW 8 111,261,863 (GRCm39) missense probably benign 0.32
R8081:Hydin UTSW 8 111,092,101 (GRCm39) missense possibly damaging 0.93
R8095:Hydin UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
R8157:Hydin UTSW 8 111,178,668 (GRCm39) missense probably benign 0.33
R8186:Hydin UTSW 8 111,336,277 (GRCm39) missense probably benign 0.14
R8205:Hydin UTSW 8 111,319,270 (GRCm39) missense possibly damaging 0.57
R8263:Hydin UTSW 8 111,178,705 (GRCm39) missense probably benign 0.00
R8288:Hydin UTSW 8 111,233,661 (GRCm39) missense probably damaging 0.96
R8298:Hydin UTSW 8 111,327,015 (GRCm39) missense probably damaging 1.00
R8309:Hydin UTSW 8 111,334,534 (GRCm39) missense probably benign 0.18
R8348:Hydin UTSW 8 111,329,878 (GRCm39) missense possibly damaging 0.68
R8356:Hydin UTSW 8 111,259,756 (GRCm39) missense possibly damaging 0.67
R8406:Hydin UTSW 8 111,336,543 (GRCm39) missense possibly damaging 0.94
R8415:Hydin UTSW 8 111,178,626 (GRCm39) missense probably damaging 1.00
R8417:Hydin UTSW 8 111,296,024 (GRCm39) missense probably benign 0.28
R8432:Hydin UTSW 8 111,324,583 (GRCm39) missense probably benign 0.02
R8437:Hydin UTSW 8 111,189,367 (GRCm39) missense probably damaging 0.96
R8463:Hydin UTSW 8 111,237,553 (GRCm39) missense probably benign 0.22
R8508:Hydin UTSW 8 111,308,650 (GRCm39) missense probably benign 0.00
R8510:Hydin UTSW 8 111,233,202 (GRCm39) missense probably damaging 1.00
R8560:Hydin UTSW 8 111,265,106 (GRCm39) missense probably benign 0.09
R8682:Hydin UTSW 8 111,035,798 (GRCm39) missense probably damaging 0.96
R8697:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R8857:Hydin UTSW 8 111,298,587 (GRCm39) critical splice donor site probably null
R8866:Hydin UTSW 8 111,308,779 (GRCm39) missense possibly damaging 0.89
R8878:Hydin UTSW 8 111,035,720 (GRCm39) missense probably benign 0.12
R8897:Hydin UTSW 8 111,316,112 (GRCm39) missense probably benign
R8987:Hydin UTSW 8 111,239,766 (GRCm39) nonsense probably null
R9072:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9073:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9102:Hydin UTSW 8 111,235,546 (GRCm39) missense probably benign 0.33
R9224:Hydin UTSW 8 111,259,516 (GRCm39) missense probably benign
R9255:Hydin UTSW 8 111,261,972 (GRCm39) missense probably benign 0.23
R9257:Hydin UTSW 8 111,301,648 (GRCm39) missense probably damaging 0.99
R9261:Hydin UTSW 8 110,994,047 (GRCm39) missense unknown
R9273:Hydin UTSW 8 111,233,580 (GRCm39) missense probably damaging 0.98
R9376:Hydin UTSW 8 111,124,695 (GRCm39) missense possibly damaging 0.70
R9380:Hydin UTSW 8 111,290,504 (GRCm39) missense probably benign 0.07
R9386:Hydin UTSW 8 111,314,362 (GRCm39) missense probably benign
R9406:Hydin UTSW 8 111,314,412 (GRCm39) missense probably null 0.96
R9492:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R9513:Hydin UTSW 8 111,322,114 (GRCm39) missense probably damaging 0.99
R9562:Hydin UTSW 8 111,312,786 (GRCm39) missense probably benign 0.11
R9664:Hydin UTSW 8 111,220,965 (GRCm39) missense probably benign 0.01
R9733:Hydin UTSW 8 111,262,011 (GRCm39) missense probably benign
R9753:Hydin UTSW 8 111,217,398 (GRCm39) missense possibly damaging 0.85
X0063:Hydin UTSW 8 111,277,951 (GRCm39) missense probably damaging 1.00
Z1088:Hydin UTSW 8 111,319,423 (GRCm39) frame shift probably null
Z1088:Hydin UTSW 8 111,312,680 (GRCm39) missense probably benign 0.00
Z1088:Hydin UTSW 8 111,026,605 (GRCm39) missense probably benign 0.12
Z1176:Hydin UTSW 8 111,268,232 (GRCm39) missense possibly damaging 0.65
Z1177:Hydin UTSW 8 111,313,774 (GRCm39) frame shift probably null
Z1177:Hydin UTSW 8 111,176,864 (GRCm39) missense possibly damaging 0.47
Z1177:Hydin UTSW 8 111,107,242 (GRCm39) missense probably damaging 1.00
Z1177:Hydin UTSW 8 111,336,621 (GRCm39) missense probably benign 0.10
Z1188:Hydin UTSW 8 111,142,419 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCTCCCATAGGCTGTCAGTC -3'
(R):5'- AGAAGATTTTGTCCTCCACGCC -3'

Sequencing Primer
(F):5'- ATAGGCTGTCAGTCCCCAC -3'
(R):5'- GTGTAGGTCAAGGCTGATT -3'
Posted On 2014-06-30