Incidental Mutation 'R1869:Pcnt'
ID210566
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission 039891-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1869 (G1)
Quality Score181
Status Not validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76379906 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2347 (E2347G)
Ref Sequence ENSEMBL: ENSMUSP00000001179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect probably null
Transcript: ENSMUST00000001179
AA Change: E2347G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: E2347G

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000001179
AA Change: E2347G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: E2347G

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000217838
AA Change: E2329G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220395
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,890,067 L110P probably damaging Het
6030458C11Rik T C 15: 12,817,907 D168G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abhd11 A G 5: 135,011,617 Y168C probably damaging Het
Actr5 A C 2: 158,638,723 T554P probably damaging Het
Adamts16 A G 13: 70,735,747 L1103P probably damaging Het
Adgrb3 A T 1: 25,826,438 I108K possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Aoc3 T A 11: 101,331,467 Y176* probably null Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Ap4b1 T A 3: 103,820,868 Y399* probably null Het
Arhgef5 A T 6: 43,288,682 I1553F probably damaging Het
Bag6 T C 17: 35,142,826 V541A probably benign Het
Bdp1 A C 13: 100,042,201 V1879G probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Bsnd C T 4: 106,486,636 V158I probably benign Het
Cachd1 C A 4: 100,983,390 H880N probably damaging Het
Ccdc27 T C 4: 154,026,763 probably null Het
Cd74 C T 18: 60,810,412 P190S probably benign Het
Cep68 A T 11: 20,240,217 L265Q probably damaging Het
Cfap70 G A 14: 20,408,610 Q772* probably null Het
CK137956 T A 4: 127,970,534 S101C possibly damaging Het
Clca3a2 G A 3: 144,806,403 T524M probably benign Het
Cxcr6 T C 9: 123,809,957 S15P probably benign Het
Cyfip2 T A 11: 46,224,168 Y904F probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Ddx56 C T 11: 6,263,993 V389M possibly damaging Het
Dmp1 A T 5: 104,212,076 D206V probably damaging Het
Dnah17 A T 11: 118,047,189 C3350* probably null Het
Dpcr1 A G 17: 35,638,413 L98P possibly damaging Het
Dst A T 1: 34,252,832 S877C probably damaging Het
Ermp1 A G 19: 29,646,015 S192P possibly damaging Het
F13b G A 1: 139,510,934 D359N probably benign Het
Fam171a1 A T 2: 3,226,152 Q769L possibly damaging Het
Fap T C 2: 62,528,727 R411G probably damaging Het
Fbn1 A G 2: 125,352,027 V1340A probably benign Het
Fbxw19 T C 9: 109,482,032 I370V probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Frem2 T G 3: 53,535,196 D2640A probably benign Het
Fzd4 T C 7: 89,407,246 V167A probably benign Het
Galnt3 T C 2: 66,097,779 I258V possibly damaging Het
Galr2 T C 11: 116,283,243 V233A possibly damaging Het
Gldc G T 19: 30,139,332 Q407K probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr89 A G 3: 96,875,659 I325T probably benign Het
Grap T A 11: 61,664,189 Y61N possibly damaging Het
Hbs1l G T 10: 21,358,406 probably null Het
Hexb T A 13: 97,191,259 E134D probably benign Het
Hydin T A 8: 110,500,705 V1507D possibly damaging Het
Igkv8-16 C A 6: 70,386,987 G17V probably benign Het
Kdm4a T A 4: 118,138,871 Q987L probably null Het
Krt76 A G 15: 101,889,487 probably null Het
Lap3 T C 5: 45,503,387 S238P probably benign Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Lipn A G 19: 34,080,739 T287A possibly damaging Het
Macf1 T C 4: 123,351,128 S466G probably damaging Het
Map3k5 C A 10: 20,132,109 S1220* probably null Het
Map4 T C 9: 110,034,964 V419A probably benign Het
Map4 T A 9: 110,068,928 S754R possibly damaging Het
Mroh9 A G 1: 163,026,513 S773P probably damaging Het
Mtus1 A C 8: 41,076,230 probably null Het
Muc1 C T 3: 89,231,810 P533S probably damaging Het
Muc13 A T 16: 33,804,600 I282F probably damaging Het
Myh14 T A 7: 44,611,643 Q1816L possibly damaging Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfml2b A G 1: 170,669,243 D481G probably damaging Het
Olfr1000 A G 2: 85,608,500 S137P probably benign Het
Olfr1087 T A 2: 86,690,391 I195F probably damaging Het
Olfr309 T A 7: 86,306,667 I149F possibly damaging Het
Olfr703 T G 7: 106,845,094 I161S probably benign Het
Olfr884 T A 9: 38,048,202 probably null Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Phax T A 18: 56,573,104 V22D probably benign Het
Pik3ca T C 3: 32,450,350 F667S probably damaging Het
Pkd1 T C 17: 24,594,931 F4123S probably damaging Het
Pkhd1 A G 1: 20,615,267 probably null Het
Plcb1 G A 2: 135,311,014 R368K probably benign Het
Prrc2a G T 17: 35,153,308 R1739S possibly damaging Het
Psg23 A T 7: 18,614,618 M88K probably benign Het
Pstk T A 7: 131,387,797 Y354N probably damaging Het
Rab39 A G 9: 53,705,931 I62T possibly damaging Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rasgrp1 T C 2: 117,290,347 Y431C probably damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf167 T A 11: 70,650,139 I197N possibly damaging Het
Rtn1 A G 12: 72,308,168 S335P probably damaging Het
Ryr2 G T 13: 11,662,075 R3297S probably damaging Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scgb1b24 T C 7: 33,744,044 Y43H probably damaging Het
Sh3rf3 T A 10: 59,083,513 M484K probably damaging Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc1a7 A G 4: 108,008,364 T350A probably damaging Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slk T C 19: 47,625,452 F916L probably damaging Het
Snap91 T A 9: 86,790,141 probably null Het
Snrpb2 A T 2: 143,065,186 R25S possibly damaging Het
Specc1l T C 10: 75,261,825 Y811H probably damaging Het
Sprr2h A G 3: 92,386,618 probably benign Het
Sult2a5 A T 7: 13,624,120 I26F probably benign Het
Syt13 C T 2: 92,946,103 T245I possibly damaging Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Telo2 T A 17: 25,114,994 D93V probably benign Het
Tet2 A T 3: 133,481,441 probably null Het
Tgm7 A T 2: 121,101,089 C198S probably damaging Het
Ticrr T C 7: 79,679,135 F674S probably damaging Het
Tmem129 C A 5: 33,654,499 C31F probably damaging Het
Tmem132a T A 19: 10,858,688 D826V possibly damaging Het
Tpd52 T C 3: 8,953,802 probably null Het
Trub2 A G 2: 29,777,666 S321P probably benign Het
Ttc29 A G 8: 78,282,385 T295A probably benign Het
Tubb1 G A 2: 174,456,689 S89N probably benign Het
Ubap2 C A 4: 41,233,617 G91V probably damaging Het
Ugt2b35 A G 5: 87,001,288 N133D probably damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn1r220 A C 13: 23,184,287 C80G probably damaging Het
Vmn1r79 A G 7: 12,176,647 E152G probably benign Het
Vmn2r28 T C 7: 5,486,346 Y498C probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Zcchc11 T A 4: 108,529,300 F1122L probably damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zfp972 A G 2: 177,921,687 probably null Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 splice site probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
R7538:Pcnt UTSW 10 76399939 missense probably benign
R7575:Pcnt UTSW 10 76389252 missense probably benign 0.32
R7662:Pcnt UTSW 10 76387522 missense probably benign 0.27
R7685:Pcnt UTSW 10 76422808 missense probably benign 0.14
R7764:Pcnt UTSW 10 76354248 missense probably benign 0.33
R7802:Pcnt UTSW 10 76375303 splice site probably null
Z1176:Pcnt UTSW 10 76382157 nonsense probably null
Z1177:Pcnt UTSW 10 76399968 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGATCGAGCAGGTTAAATTCAGG -3'
(R):5'- GGATGTCTCCTTTCCACACAG -3'

Sequencing Primer
(F):5'- GCAGGTTAAATTCAGGCCATAG -3'
(R):5'- ACACAGCTCATTGCCGTC -3'
Posted On2014-06-30