Incidental Mutation 'R1869:Usp34'
ID 210572
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 039891-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R1869 (G1)
Quality Score 212
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23314479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 807 (H807R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000137823
AA Change: H807R

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: H807R

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: H788R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: H788R

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,840,067 (GRCm39) L110P probably damaging Het
6030458C11Rik T C 15: 12,817,993 (GRCm39) D168G probably damaging Het
Abca13 A T 11: 9,242,134 (GRCm39) E1332D probably benign Het
Abhd11 A G 5: 135,040,471 (GRCm39) Y168C probably damaging Het
Actr5 A C 2: 158,480,643 (GRCm39) T554P probably damaging Het
Adam34l A T 8: 44,078,132 (GRCm39) Y697* probably null Het
Adamts16 A G 13: 70,883,866 (GRCm39) L1103P probably damaging Het
Adgrb3 A T 1: 25,865,519 (GRCm39) I108K possibly damaging Het
Agbl4 T A 4: 111,423,826 (GRCm39) M284K possibly damaging Het
Aoc3 T A 11: 101,222,293 (GRCm39) Y176* probably null Het
Aox1 A G 1: 58,115,262 (GRCm39) E749G probably damaging Het
Ap4b1 T A 3: 103,728,184 (GRCm39) Y399* probably null Het
Arhgef5 A T 6: 43,265,616 (GRCm39) I1553F probably damaging Het
Bag6 T C 17: 35,361,802 (GRCm39) V541A probably benign Het
Bdp1 A C 13: 100,178,709 (GRCm39) V1879G probably damaging Het
Bod1l G A 5: 41,991,018 (GRCm39) S179F possibly damaging Het
Bsnd C T 4: 106,343,833 (GRCm39) V158I probably benign Het
Cachd1 C A 4: 100,840,587 (GRCm39) H880N probably damaging Het
Ccdc27 T C 4: 154,111,220 (GRCm39) probably null Het
Cd74 C T 18: 60,943,484 (GRCm39) P190S probably benign Het
Cep68 A T 11: 20,190,217 (GRCm39) L265Q probably damaging Het
Cfap70 G A 14: 20,458,678 (GRCm39) Q772* probably null Het
CK137956 T A 4: 127,864,327 (GRCm39) S101C possibly damaging Het
Clca3a2 G A 3: 144,512,164 (GRCm39) T524M probably benign Het
Cxcr6 T C 9: 123,639,022 (GRCm39) S15P probably benign Het
Cyfip2 T A 11: 46,114,995 (GRCm39) Y904F probably benign Het
D130040H23Rik T A 8: 69,755,354 (GRCm39) I253N probably benign Het
Ddx56 C T 11: 6,213,993 (GRCm39) V389M possibly damaging Het
Dmp1 A T 5: 104,359,942 (GRCm39) D206V probably damaging Het
Dnah17 A T 11: 117,938,015 (GRCm39) C3350* probably null Het
Dst A T 1: 34,291,913 (GRCm39) S877C probably damaging Het
Ermp1 A G 19: 29,623,415 (GRCm39) S192P possibly damaging Het
F13b G A 1: 139,438,672 (GRCm39) D359N probably benign Het
Fam171a1 A T 2: 3,227,189 (GRCm39) Q769L possibly damaging Het
Fap T C 2: 62,359,071 (GRCm39) R411G probably damaging Het
Fbn1 A G 2: 125,193,947 (GRCm39) V1340A probably benign Het
Fbxw19 T C 9: 109,311,100 (GRCm39) I370V probably benign Het
Foxi1 A T 11: 34,157,937 (GRCm39) N29K possibly damaging Het
Frem2 T G 3: 53,442,617 (GRCm39) D2640A probably benign Het
Fzd4 T C 7: 89,056,454 (GRCm39) V167A probably benign Het
Galnt3 T C 2: 65,928,123 (GRCm39) I258V possibly damaging Het
Galr2 T C 11: 116,174,069 (GRCm39) V233A possibly damaging Het
Gldc G T 19: 30,116,732 (GRCm39) Q407K probably benign Het
Gmcl1 T C 6: 86,674,498 (GRCm39) D460G probably benign Het
Gpr89 A G 3: 96,782,975 (GRCm39) I325T probably benign Het
Grap T A 11: 61,555,015 (GRCm39) Y61N possibly damaging Het
Hbs1l G T 10: 21,234,305 (GRCm39) probably null Het
Hexb T A 13: 97,327,767 (GRCm39) E134D probably benign Het
Hydin T A 8: 111,227,337 (GRCm39) V1507D possibly damaging Het
Igkv8-16 C A 6: 70,363,971 (GRCm39) G17V probably benign Het
Kdm4a T A 4: 117,996,068 (GRCm39) Q987L probably null Het
Krt76 A G 15: 101,797,922 (GRCm39) probably null Het
Lap3 T C 5: 45,660,729 (GRCm39) S238P probably benign Het
Letm2 T C 8: 26,071,729 (GRCm39) D391G probably damaging Het
Lipn A G 19: 34,058,139 (GRCm39) T287A possibly damaging Het
Macf1 T C 4: 123,244,921 (GRCm39) S466G probably damaging Het
Map3k5 C A 10: 20,007,855 (GRCm39) S1220* probably null Het
Map4 T A 9: 109,897,996 (GRCm39) S754R possibly damaging Het
Map4 T C 9: 109,864,032 (GRCm39) V419A probably benign Het
Mroh9 A G 1: 162,854,082 (GRCm39) S773P probably damaging Het
Mtus1 A C 8: 41,529,267 (GRCm39) probably null Het
Muc1 C T 3: 89,139,117 (GRCm39) P533S probably damaging Het
Muc13 A T 16: 33,624,970 (GRCm39) I282F probably damaging Het
Mucl3 A G 17: 35,949,305 (GRCm39) L98P possibly damaging Het
Myh14 T A 7: 44,261,067 (GRCm39) Q1816L possibly damaging Het
Nalcn A C 14: 123,831,965 (GRCm39) V103G possibly damaging Het
Nlrp9c G A 7: 26,084,245 (GRCm39) Q445* probably null Het
Olfml2b A G 1: 170,496,812 (GRCm39) D481G probably damaging Het
Or13g1 T A 7: 85,955,875 (GRCm39) I149F possibly damaging Het
Or2ag19 T G 7: 106,444,301 (GRCm39) I161S probably benign Het
Or5g23 A G 2: 85,438,844 (GRCm39) S137P probably benign Het
Or8b37 T A 9: 37,959,498 (GRCm39) probably null Het
Or8k3b T A 2: 86,520,735 (GRCm39) I195F probably damaging Het
Pcdhb2 A T 18: 37,430,408 (GRCm39) probably null Het
Pcdhb22 A C 18: 37,652,200 (GRCm39) T223P probably damaging Het
Pcdhga1 T A 18: 37,973,143 (GRCm39) N907K probably damaging Het
Pcnt T C 10: 76,215,740 (GRCm39) E2347G probably null Het
Phax T A 18: 56,706,176 (GRCm39) V22D probably benign Het
Pik3ca T C 3: 32,504,499 (GRCm39) F667S probably damaging Het
Pkd1 T C 17: 24,813,905 (GRCm39) F4123S probably damaging Het
Pkhd1 A G 1: 20,685,491 (GRCm39) probably null Het
Plcb1 G A 2: 135,152,934 (GRCm39) R368K probably benign Het
Prrc2a G T 17: 35,372,284 (GRCm39) R1739S possibly damaging Het
Psg23 A T 7: 18,348,543 (GRCm39) M88K probably benign Het
Pstk T A 7: 130,989,526 (GRCm39) Y354N probably damaging Het
Rab39 A G 9: 53,617,231 (GRCm39) I62T possibly damaging Het
Ranbp2 A G 10: 58,328,383 (GRCm39) I2800V probably damaging Het
Rasgrp1 T C 2: 117,120,828 (GRCm39) Y431C probably damaging Het
Rest T A 5: 77,416,209 (GRCm39) V141E possibly damaging Het
Rnf167 T A 11: 70,540,965 (GRCm39) I197N possibly damaging Het
Rtn1 A G 12: 72,354,942 (GRCm39) S335P probably damaging Het
Ryr2 G T 13: 11,676,961 (GRCm39) R3297S probably damaging Het
S1pr3 A C 13: 51,573,952 (GRCm39) K378Q probably benign Het
Scgb1b24 T C 7: 33,443,469 (GRCm39) Y43H probably damaging Het
Sh3rf3 T A 10: 58,919,335 (GRCm39) M484K probably damaging Het
Shank1 A T 7: 43,991,539 (GRCm39) R69* probably null Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Slc1a7 A G 4: 107,865,561 (GRCm39) T350A probably damaging Het
Slc25a54 T A 3: 108,987,932 (GRCm39) Y24* probably null Het
Slk T C 19: 47,613,891 (GRCm39) F916L probably damaging Het
Snap91 T A 9: 86,672,194 (GRCm39) probably null Het
Snrpb2 A T 2: 142,907,106 (GRCm39) R25S possibly damaging Het
Specc1l T C 10: 75,097,659 (GRCm39) Y811H probably damaging Het
Sprr2h A G 3: 92,293,925 (GRCm39) probably benign Het
Sult2a5 A T 7: 13,358,045 (GRCm39) I26F probably benign Het
Syt13 C T 2: 92,776,448 (GRCm39) T245I possibly damaging Het
Tecrl T A 5: 83,502,706 (GRCm39) T33S probably benign Het
Telo2 T A 17: 25,333,968 (GRCm39) D93V probably benign Het
Tet2 A T 3: 133,187,202 (GRCm39) probably null Het
Tgm7 A T 2: 120,931,570 (GRCm39) C198S probably damaging Het
Ticrr T C 7: 79,328,883 (GRCm39) F674S probably damaging Het
Tmem129 C A 5: 33,811,843 (GRCm39) C31F probably damaging Het
Tmem132a T A 19: 10,836,052 (GRCm39) D826V possibly damaging Het
Tpd52 T C 3: 9,018,862 (GRCm39) probably null Het
Trub2 A G 2: 29,667,678 (GRCm39) S321P probably benign Het
Ttc29 A G 8: 79,009,014 (GRCm39) T295A probably benign Het
Tubb1 G A 2: 174,298,482 (GRCm39) S89N probably benign Het
Tut4 T A 4: 108,386,497 (GRCm39) F1122L probably damaging Het
Ubap2 C A 4: 41,233,617 (GRCm39) G91V probably damaging Het
Ugt2b35 A G 5: 87,149,147 (GRCm39) N133D probably damaging Het
Vmn1r220 A C 13: 23,368,457 (GRCm39) C80G probably damaging Het
Vmn1r79 A G 7: 11,910,574 (GRCm39) E152G probably benign Het
Vmn2r28 T C 7: 5,489,345 (GRCm39) Y498C probably benign Het
Wif1 A G 10: 120,920,824 (GRCm39) I215M probably benign Het
Wnk1 T C 6: 119,928,050 (GRCm39) T1134A probably damaging Het
Zfp90 A G 8: 107,145,755 (GRCm39) H29R probably benign Het
Zfp972 A G 2: 177,563,480 (GRCm39) probably null Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGAAGTGAGTTCTGCTC -3'
(R):5'- ACTAGCAACAATCATAGTCTTAGCC -3'

Sequencing Primer
(F):5'- TCACTTAGCACAAGGTTCTCAGGAG -3'
(R):5'- ATATCAACTGAAGAAATACTAGC -3'
Posted On 2014-06-30