Incidental Mutation 'R0121:Cul7'
ID21059
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Namecullin 7
Synonymsp185, 2510004L20Rik, C230011P08Rik, p193
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0121 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46650337-46664364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46663373 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1489 (L1489F)
Ref Sequence ENSEMBL: ENSMUSP00000049128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024766] [ENSMUST00000043464] [ENSMUST00000133393] [ENSMUST00000145567]
Predicted Effect probably benign
Transcript: ENSMUST00000024766
SMART Domains Protein: ENSMUSP00000024766
Gene: ENSMUSG00000023971

DomainStartEndE-ValueType
Pfam:DUF947 55 219 7.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043464
AA Change: L1489F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: L1489F

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125949
Predicted Effect probably benign
Transcript: ENSMUST00000133393
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145567
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.1229 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46652508 missense probably damaging 1.00
IGL01288:Cul7 APN 17 46657807 splice site probably benign
IGL01669:Cul7 APN 17 46658715 missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46660247 splice site probably benign
PIT4453001:Cul7 UTSW 17 46651820 missense probably damaging 0.99
R0083:Cul7 UTSW 17 46655556 missense probably benign 0.00
R0157:Cul7 UTSW 17 46653835 missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46654595 missense probably benign 0.00
R0358:Cul7 UTSW 17 46663744 critical splice donor site probably null
R0544:Cul7 UTSW 17 46663544 missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46652003 missense probably damaging 0.98
R0677:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0696:Cul7 UTSW 17 46659608 missense probably damaging 1.00
R0702:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0735:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0893:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0900:Cul7 UTSW 17 46658337 missense probably benign 0.36
R0975:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0976:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1014:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1016:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1104:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1162:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1378:Cul7 UTSW 17 46662126 missense probably damaging 0.99
R1479:Cul7 UTSW 17 46651747 missense probably damaging 1.00
R1498:Cul7 UTSW 17 46655710 missense probably benign 0.01
R1521:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1542:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1545:Cul7 UTSW 17 46651553 missense probably damaging 1.00
R1598:Cul7 UTSW 17 46663091 missense probably benign 0.10
R1600:Cul7 UTSW 17 46651822 nonsense probably null
R1618:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1752:Cul7 UTSW 17 46653167 missense probably benign 0.10
R1881:Cul7 UTSW 17 46651962 missense probably damaging 1.00
R1901:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1902:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1913:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R2213:Cul7 UTSW 17 46651472 missense probably damaging 0.99
R2370:Cul7 UTSW 17 46661641 missense probably damaging 1.00
R2929:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2930:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2990:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2992:Cul7 UTSW 17 46651600 missense probably benign 0.00
R4201:Cul7 UTSW 17 46661312 missense probably damaging 1.00
R4792:Cul7 UTSW 17 46657050 nonsense probably null
R4971:Cul7 UTSW 17 46659119 missense probably benign 0.00
R5014:Cul7 UTSW 17 46655942 makesense probably null
R5384:Cul7 UTSW 17 46654477 missense probably benign 0.44
R5957:Cul7 UTSW 17 46657757 missense probably damaging 1.00
R6128:Cul7 UTSW 17 46651662 missense probably damaging 1.00
R6294:Cul7 UTSW 17 46663148 missense probably benign
R6812:Cul7 UTSW 17 46661409 missense probably benign 0.00
R7073:Cul7 UTSW 17 46658731 missense probably damaging 1.00
R7112:Cul7 UTSW 17 46651698 missense probably damaging 1.00
R7246:Cul7 UTSW 17 46662067 missense probably benign 0.04
R7361:Cul7 UTSW 17 46657007 missense probably damaging 1.00
R7567:Cul7 UTSW 17 46654595 missense probably benign 0.00
R7682:Cul7 UTSW 17 46655595 missense probably benign
R7689:Cul7 UTSW 17 46652821 nonsense probably null
R7797:Cul7 UTSW 17 46658642 missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46658005 missense probably benign
R7980:Cul7 UTSW 17 46658005 missense probably benign
Z1177:Cul7 UTSW 17 46652805 frame shift probably null
Z1177:Cul7 UTSW 17 46658738 missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46659569 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCCAGCTTAGAGAAAGAGCCAC -3'
(R):5'- CACCCCTGTAAGGAACATTGGTCAC -3'

Sequencing Primer
(F):5'- TGCATGTGTCCACAGTACAG -3'
(R):5'- AGGAACATTGGTCACTTGCC -3'
Posted On2013-04-11