Incidental Mutation 'R1869:Pkd1'
ID210593
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission 039891-MU
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1869 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24594931 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 4123 (F4123S)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227058] [ENSMUST00000227607] [ENSMUST00000227804] [ENSMUST00000227745] [ENSMUST00000228412] [ENSMUST00000228581]
Predicted Effect probably damaging
Transcript: ENSMUST00000035565
AA Change: F4123S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: F4123S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097373
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116692
Predicted Effect probably benign
Transcript: ENSMUST00000226284
Predicted Effect probably benign
Transcript: ENSMUST00000226398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226691
Predicted Effect probably benign
Transcript: ENSMUST00000227058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227094
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227432
Predicted Effect probably benign
Transcript: ENSMUST00000227607
Predicted Effect probably benign
Transcript: ENSMUST00000227804
Predicted Effect probably benign
Transcript: ENSMUST00000227745
Predicted Effect probably benign
Transcript: ENSMUST00000228412
Predicted Effect probably benign
Transcript: ENSMUST00000228581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228750
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,890,067 L110P probably damaging Het
6030458C11Rik T C 15: 12,817,907 D168G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abhd11 A G 5: 135,011,617 Y168C probably damaging Het
Actr5 A C 2: 158,638,723 T554P probably damaging Het
Adamts16 A G 13: 70,735,747 L1103P probably damaging Het
Adgrb3 A T 1: 25,826,438 I108K possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Aoc3 T A 11: 101,331,467 Y176* probably null Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Ap4b1 T A 3: 103,820,868 Y399* probably null Het
Arhgef5 A T 6: 43,288,682 I1553F probably damaging Het
Bag6 T C 17: 35,142,826 V541A probably benign Het
Bdp1 A C 13: 100,042,201 V1879G probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Bsnd C T 4: 106,486,636 V158I probably benign Het
Cachd1 C A 4: 100,983,390 H880N probably damaging Het
Ccdc27 T C 4: 154,026,763 probably null Het
Cd74 C T 18: 60,810,412 P190S probably benign Het
Cep68 A T 11: 20,240,217 L265Q probably damaging Het
Cfap70 G A 14: 20,408,610 Q772* probably null Het
CK137956 T A 4: 127,970,534 S101C possibly damaging Het
Clca3a2 G A 3: 144,806,403 T524M probably benign Het
Cxcr6 T C 9: 123,809,957 S15P probably benign Het
Cyfip2 T A 11: 46,224,168 Y904F probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Ddx56 C T 11: 6,263,993 V389M possibly damaging Het
Dmp1 A T 5: 104,212,076 D206V probably damaging Het
Dnah17 A T 11: 118,047,189 C3350* probably null Het
Dpcr1 A G 17: 35,638,413 L98P possibly damaging Het
Dst A T 1: 34,252,832 S877C probably damaging Het
Ermp1 A G 19: 29,646,015 S192P possibly damaging Het
F13b G A 1: 139,510,934 D359N probably benign Het
Fam171a1 A T 2: 3,226,152 Q769L possibly damaging Het
Fap T C 2: 62,528,727 R411G probably damaging Het
Fbn1 A G 2: 125,352,027 V1340A probably benign Het
Fbxw19 T C 9: 109,482,032 I370V probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Frem2 T G 3: 53,535,196 D2640A probably benign Het
Fzd4 T C 7: 89,407,246 V167A probably benign Het
Galnt3 T C 2: 66,097,779 I258V possibly damaging Het
Galr2 T C 11: 116,283,243 V233A possibly damaging Het
Gldc G T 19: 30,139,332 Q407K probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr89 A G 3: 96,875,659 I325T probably benign Het
Grap T A 11: 61,664,189 Y61N possibly damaging Het
Hbs1l G T 10: 21,358,406 probably null Het
Hexb T A 13: 97,191,259 E134D probably benign Het
Hydin T A 8: 110,500,705 V1507D possibly damaging Het
Igkv8-16 C A 6: 70,386,987 G17V probably benign Het
Kdm4a T A 4: 118,138,871 Q987L probably null Het
Krt76 A G 15: 101,889,487 probably null Het
Lap3 T C 5: 45,503,387 S238P probably benign Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Lipn A G 19: 34,080,739 T287A possibly damaging Het
Macf1 T C 4: 123,351,128 S466G probably damaging Het
Map3k5 C A 10: 20,132,109 S1220* probably null Het
Map4 T C 9: 110,034,964 V419A probably benign Het
Map4 T A 9: 110,068,928 S754R possibly damaging Het
Mroh9 A G 1: 163,026,513 S773P probably damaging Het
Mtus1 A C 8: 41,076,230 probably null Het
Muc1 C T 3: 89,231,810 P533S probably damaging Het
Muc13 A T 16: 33,804,600 I282F probably damaging Het
Myh14 T A 7: 44,611,643 Q1816L possibly damaging Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfml2b A G 1: 170,669,243 D481G probably damaging Het
Olfr1000 A G 2: 85,608,500 S137P probably benign Het
Olfr1087 T A 2: 86,690,391 I195F probably damaging Het
Olfr309 T A 7: 86,306,667 I149F possibly damaging Het
Olfr703 T G 7: 106,845,094 I161S probably benign Het
Olfr884 T A 9: 38,048,202 probably null Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pcnt T C 10: 76,379,906 E2347G probably null Het
Phax T A 18: 56,573,104 V22D probably benign Het
Pik3ca T C 3: 32,450,350 F667S probably damaging Het
Pkhd1 A G 1: 20,615,267 probably null Het
Plcb1 G A 2: 135,311,014 R368K probably benign Het
Prrc2a G T 17: 35,153,308 R1739S possibly damaging Het
Psg23 A T 7: 18,614,618 M88K probably benign Het
Pstk T A 7: 131,387,797 Y354N probably damaging Het
Rab39 A G 9: 53,705,931 I62T possibly damaging Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rasgrp1 T C 2: 117,290,347 Y431C probably damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf167 T A 11: 70,650,139 I197N possibly damaging Het
Rtn1 A G 12: 72,308,168 S335P probably damaging Het
Ryr2 G T 13: 11,662,075 R3297S probably damaging Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scgb1b24 T C 7: 33,744,044 Y43H probably damaging Het
Sh3rf3 T A 10: 59,083,513 M484K probably damaging Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc1a7 A G 4: 108,008,364 T350A probably damaging Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slk T C 19: 47,625,452 F916L probably damaging Het
Snap91 T A 9: 86,790,141 probably null Het
Snrpb2 A T 2: 143,065,186 R25S possibly damaging Het
Specc1l T C 10: 75,261,825 Y811H probably damaging Het
Sprr2h A G 3: 92,386,618 probably benign Het
Sult2a5 A T 7: 13,624,120 I26F probably benign Het
Syt13 C T 2: 92,946,103 T245I possibly damaging Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Telo2 T A 17: 25,114,994 D93V probably benign Het
Tet2 A T 3: 133,481,441 probably null Het
Tgm7 A T 2: 121,101,089 C198S probably damaging Het
Ticrr T C 7: 79,679,135 F674S probably damaging Het
Tmem129 C A 5: 33,654,499 C31F probably damaging Het
Tmem132a T A 19: 10,858,688 D826V possibly damaging Het
Tpd52 T C 3: 8,953,802 probably null Het
Trub2 A G 2: 29,777,666 S321P probably benign Het
Ttc29 A G 8: 78,282,385 T295A probably benign Het
Tubb1 G A 2: 174,456,689 S89N probably benign Het
Ubap2 C A 4: 41,233,617 G91V probably damaging Het
Ugt2b35 A G 5: 87,001,288 N133D probably damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn1r220 A C 13: 23,184,287 C80G probably damaging Het
Vmn1r79 A G 7: 12,176,647 E152G probably benign Het
Vmn2r28 T C 7: 5,486,346 Y498C probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Zcchc11 T A 4: 108,529,300 F1122L probably damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zfp972 A G 2: 177,921,687 probably null Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 splice site probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24577801 missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24574029 missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 splice site probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
R6999:Pkd1 UTSW 17 24578501 missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24591119 missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24594768 missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24594112 missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24575866 missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24575051 missense probably benign 0.01
R7380:Pkd1 UTSW 17 24581642 missense probably damaging 1.00
R7407:Pkd1 UTSW 17 24594594 missense probably damaging 1.00
R7410:Pkd1 UTSW 17 24575881 missense probably damaging 1.00
R7492:Pkd1 UTSW 17 24569741 missense probably benign 0.04
R7517:Pkd1 UTSW 17 24580419 missense probably damaging 1.00
R7543:Pkd1 UTSW 17 24595253 missense probably damaging 0.99
R7560:Pkd1 UTSW 17 24573631 missense probably benign 0.33
R7615:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R7714:Pkd1 UTSW 17 24550276 missense unknown
R7718:Pkd1 UTSW 17 24586500 missense probably benign 0.15
R7731:Pkd1 UTSW 17 24573898 missense probably damaging 1.00
R7849:Pkd1 UTSW 17 24586200 missense probably damaging 0.98
R7859:Pkd1 UTSW 17 24571280 missense probably damaging 1.00
R7866:Pkd1 UTSW 17 24590907 missense probably benign 0.26
R7915:Pkd1 UTSW 17 24592656 nonsense probably null
R7991:Pkd1 UTSW 17 24572621 missense possibly damaging 0.95
R8050:Pkd1 UTSW 17 24565643 missense probably benign 0.26
R8086:Pkd1 UTSW 17 24581214 missense probably damaging 1.00
R8312:Pkd1 UTSW 17 24567128 missense probably benign 0.02
R8385:Pkd1 UTSW 17 24575728 missense possibly damaging 0.67
R8393:Pkd1 UTSW 17 24572647 missense probably damaging 0.99
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Z1177:Pkd1 UTSW 17 24575491 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTACAACATGGCCCGTG -3'
(R):5'- CAGTGGATCCATTCCTTCAAAG -3'

Sequencing Primer
(F):5'- AGGGTCCCCACTCTGTG -3'
(R):5'- GGATCCATTCCTTCAAAGCGGAC -3'
Posted On2014-06-30