Incidental Mutation 'R1869:Pcdhga1'
ID210600
Institutional Source Beutler Lab
Gene Symbol Pcdhga1
Ensembl Gene ENSMUSG00000103144
Gene Nameprotocadherin gamma subfamily A, 1
Synonyms
MMRRC Submission 039891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1869 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37661793-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37840090 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 907 (N907K)
Ref Sequence ENSEMBL: ENSMUSP00000111325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000025337] [ENSMUST00000044851] [ENSMUST00000055935] [ENSMUST00000061279] [ENSMUST00000066140] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000076807] [ENSMUST00000080033] [ENSMUST00000091935] [ENSMUST00000115629] [ENSMUST00000195112] [ENSMUST00000194190] [ENSMUST00000193404] [ENSMUST00000192511] [ENSMUST00000192931] [ENSMUST00000193869] [ENSMUST00000193414] [ENSMUST00000195363] [ENSMUST00000194928] [ENSMUST00000115661] [ENSMUST00000194418] [ENSMUST00000192535] [ENSMUST00000195239] [ENSMUST00000115631] [ENSMUST00000115634] [ENSMUST00000192103] [ENSMUST00000193890] [ENSMUST00000193941] [ENSMUST00000195823] [ENSMUST00000208907] [ENSMUST00000195764]
PDB Structure
Structure of EC1 domain of CNR [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000003599
AA Change: N918K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088
AA Change: N918K

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025337
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000044851
AA Change: N920K
SMART Domains Protein: ENSMUSP00000036359
Gene: ENSMUSG00000102428
AA Change: N920K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
CA 45 131 3.28e-1 SMART
CA 155 240 1.8e-17 SMART
CA 264 345 9.22e-24 SMART
CA 369 450 1.28e-22 SMART
CA 474 560 1.09e-25 SMART
CA 591 669 9.24e-15 SMART
Pfam:Cadherin_C_2 688 772 3.6e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000055935
AA Change: N932K
SMART Domains Protein: ENSMUSP00000060949
Gene: ENSMUSG00000102543
AA Change: N932K

DomainStartEndE-ValueType
CA 54 131 3.02e-2 SMART
CA 155 240 6.84e-18 SMART
CA 264 348 7.91e-23 SMART
CA 372 452 4.4e-21 SMART
CA 476 562 3.31e-25 SMART
CA 592 674 5.69e-15 SMART
Pfam:Cadherin_C_2 689 791 1.1e-18 PFAM
low complexity region 808 819 N/A INTRINSIC
Pfam:Cadherin_tail 821 944 8.3e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000061279
AA Change: N921K
SMART Domains Protein: ENSMUSP00000058362
Gene: ENSMUSG00000102742
AA Change: N921K

DomainStartEndE-ValueType
CA 45 131 3.23e-2 SMART
CA 155 240 2.22e-17 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 7.09e-25 SMART
CA 474 560 3.55e-25 SMART
CA 591 669 2.53e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 914 933 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066140
AA Change: N929K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068846
Gene: ENSMUSG00000023036
AA Change: N929K

DomainStartEndE-ValueType
CA 52 134 4.39e-1 SMART
CA 158 243 1.25e-20 SMART
CA 267 351 5.09e-26 SMART
CA 375 456 1.26e-21 SMART
CA 480 566 6.56e-29 SMART
CA 596 674 6.95e-10 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 922 941 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000066149
AA Change: N920K
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897
AA Change: N920K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000073447
AA Change: N916K
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346
AA Change: N916K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000076807
AA Change: N922K
SMART Domains Protein: ENSMUSP00000076085
Gene: ENSMUSG00000102918
AA Change: N922K

DomainStartEndE-ValueType
low complexity region 20 26 N/A INTRINSIC
CA 51 133 8.56e-3 SMART
CA 157 242 1.78e-16 SMART
CA 266 350 2.18e-25 SMART
CA 374 455 7.09e-25 SMART
CA 479 565 1.87e-24 SMART
CA 593 674 1.79e-12 SMART
Pfam:Cadherin_C_2 689 774 3.9e-14 PFAM
Pfam:Cadherin_tail 811 934 8.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080033
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000091935
AA Change: N920K
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440
AA Change: N920K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115629
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194980
Predicted Effect unknown
Transcript: ENSMUST00000195112
AA Change: N916K
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748
AA Change: N916K

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194190
AA Change: N919K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144
AA Change: N919K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193404
AA Change: N918K
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222
AA Change: N918K

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192984
Predicted Effect unknown
Transcript: ENSMUST00000192511
AA Change: N923K
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472
AA Change: N923K

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192931
AA Change: N906K
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037
AA Change: N906K

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193869
AA Change: N919K
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332
AA Change: N919K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193414
AA Change: N920K
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567
AA Change: N920K

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195363
AA Change: N900K
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585
AA Change: N900K

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194928
AA Change: N917K
SMART Domains Protein: ENSMUSP00000141997
Gene: ENSMUSG00000104063
AA Change: N917K

DomainStartEndE-ValueType
CA 47 131 2.48e-6 SMART
CA 155 240 1.57e-17 SMART
CA 264 343 1.29e-27 SMART
CA 367 448 9.14e-28 SMART
CA 472 558 1.24e-24 SMART
CA 589 670 3.73e-10 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 716 721 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115661
AA Change: N907K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458
AA Change: N907K

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194418
AA Change: N918K
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677
AA Change: N918K

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192861
Predicted Effect probably benign
Transcript: ENSMUST00000192535
AA Change: N914K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749
AA Change: N914K

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195239
AA Change: N119K
SMART Domains Protein: ENSMUSP00000141244
Gene: ENSMUSG00000023036
AA Change: N119K

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192109
Predicted Effect probably benign
Transcript: ENSMUST00000115631
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115634
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192103
SMART Domains Protein: ENSMUSP00000141611
Gene: ENSMUSG00000102918

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_2 31 78 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193890
Predicted Effect probably benign
Transcript: ENSMUST00000193941
Predicted Effect probably benign
Transcript: ENSMUST00000195823
AA Change: N920K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793
AA Change: N920K

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208907
AA Change: N919K
Predicted Effect unknown
Transcript: ENSMUST00000195764
AA Change: N919K
SMART Domains Protein: ENSMUSP00000142272
Gene: ENSMUSG00000103081
AA Change: N919K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 57 132 1.5e-4 SMART
CA 156 241 1.2e-20 SMART
CA 265 346 7.8e-29 SMART
CA 370 451 1.7e-26 SMART
CA 475 561 2.2e-26 SMART
CA 592 673 6.4e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null/reporter allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,890,067 L110P probably damaging Het
6030458C11Rik T C 15: 12,817,907 D168G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abhd11 A G 5: 135,011,617 Y168C probably damaging Het
Actr5 A C 2: 158,638,723 T554P probably damaging Het
Adamts16 A G 13: 70,735,747 L1103P probably damaging Het
Adgrb3 A T 1: 25,826,438 I108K possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Aoc3 T A 11: 101,331,467 Y176* probably null Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Ap4b1 T A 3: 103,820,868 Y399* probably null Het
Arhgef5 A T 6: 43,288,682 I1553F probably damaging Het
Bag6 T C 17: 35,142,826 V541A probably benign Het
Bdp1 A C 13: 100,042,201 V1879G probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Bsnd C T 4: 106,486,636 V158I probably benign Het
Cachd1 C A 4: 100,983,390 H880N probably damaging Het
Ccdc27 T C 4: 154,026,763 probably null Het
Cd74 C T 18: 60,810,412 P190S probably benign Het
Cep68 A T 11: 20,240,217 L265Q probably damaging Het
Cfap70 G A 14: 20,408,610 Q772* probably null Het
CK137956 T A 4: 127,970,534 S101C possibly damaging Het
Clca3a2 G A 3: 144,806,403 T524M probably benign Het
Cxcr6 T C 9: 123,809,957 S15P probably benign Het
Cyfip2 T A 11: 46,224,168 Y904F probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Ddx56 C T 11: 6,263,993 V389M possibly damaging Het
Dmp1 A T 5: 104,212,076 D206V probably damaging Het
Dnah17 A T 11: 118,047,189 C3350* probably null Het
Dpcr1 A G 17: 35,638,413 L98P possibly damaging Het
Dst A T 1: 34,252,832 S877C probably damaging Het
Ermp1 A G 19: 29,646,015 S192P possibly damaging Het
F13b G A 1: 139,510,934 D359N probably benign Het
Fam171a1 A T 2: 3,226,152 Q769L possibly damaging Het
Fap T C 2: 62,528,727 R411G probably damaging Het
Fbn1 A G 2: 125,352,027 V1340A probably benign Het
Fbxw19 T C 9: 109,482,032 I370V probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Frem2 T G 3: 53,535,196 D2640A probably benign Het
Fzd4 T C 7: 89,407,246 V167A probably benign Het
Galnt3 T C 2: 66,097,779 I258V possibly damaging Het
Galr2 T C 11: 116,283,243 V233A possibly damaging Het
Gldc G T 19: 30,139,332 Q407K probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr89 A G 3: 96,875,659 I325T probably benign Het
Grap T A 11: 61,664,189 Y61N possibly damaging Het
Hbs1l G T 10: 21,358,406 probably null Het
Hexb T A 13: 97,191,259 E134D probably benign Het
Hydin T A 8: 110,500,705 V1507D possibly damaging Het
Igkv8-16 C A 6: 70,386,987 G17V probably benign Het
Kdm4a T A 4: 118,138,871 Q987L probably null Het
Krt76 A G 15: 101,889,487 probably null Het
Lap3 T C 5: 45,503,387 S238P probably benign Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Lipn A G 19: 34,080,739 T287A possibly damaging Het
Macf1 T C 4: 123,351,128 S466G probably damaging Het
Map3k5 C A 10: 20,132,109 S1220* probably null Het
Map4 T C 9: 110,034,964 V419A probably benign Het
Map4 T A 9: 110,068,928 S754R possibly damaging Het
Mroh9 A G 1: 163,026,513 S773P probably damaging Het
Mtus1 A C 8: 41,076,230 probably null Het
Muc1 C T 3: 89,231,810 P533S probably damaging Het
Muc13 A T 16: 33,804,600 I282F probably damaging Het
Myh14 T A 7: 44,611,643 Q1816L possibly damaging Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfml2b A G 1: 170,669,243 D481G probably damaging Het
Olfr1000 A G 2: 85,608,500 S137P probably benign Het
Olfr1087 T A 2: 86,690,391 I195F probably damaging Het
Olfr309 T A 7: 86,306,667 I149F possibly damaging Het
Olfr703 T G 7: 106,845,094 I161S probably benign Het
Olfr884 T A 9: 38,048,202 probably null Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcnt T C 10: 76,379,906 E2347G probably null Het
Phax T A 18: 56,573,104 V22D probably benign Het
Pik3ca T C 3: 32,450,350 F667S probably damaging Het
Pkd1 T C 17: 24,594,931 F4123S probably damaging Het
Pkhd1 A G 1: 20,615,267 probably null Het
Plcb1 G A 2: 135,311,014 R368K probably benign Het
Prrc2a G T 17: 35,153,308 R1739S possibly damaging Het
Psg23 A T 7: 18,614,618 M88K probably benign Het
Pstk T A 7: 131,387,797 Y354N probably damaging Het
Rab39 A G 9: 53,705,931 I62T possibly damaging Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rasgrp1 T C 2: 117,290,347 Y431C probably damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf167 T A 11: 70,650,139 I197N possibly damaging Het
Rtn1 A G 12: 72,308,168 S335P probably damaging Het
Ryr2 G T 13: 11,662,075 R3297S probably damaging Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scgb1b24 T C 7: 33,744,044 Y43H probably damaging Het
Sh3rf3 T A 10: 59,083,513 M484K probably damaging Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc1a7 A G 4: 108,008,364 T350A probably damaging Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slk T C 19: 47,625,452 F916L probably damaging Het
Snap91 T A 9: 86,790,141 probably null Het
Snrpb2 A T 2: 143,065,186 R25S possibly damaging Het
Specc1l T C 10: 75,261,825 Y811H probably damaging Het
Sprr2h A G 3: 92,386,618 probably benign Het
Sult2a5 A T 7: 13,624,120 I26F probably benign Het
Syt13 C T 2: 92,946,103 T245I possibly damaging Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Telo2 T A 17: 25,114,994 D93V probably benign Het
Tet2 A T 3: 133,481,441 probably null Het
Tgm7 A T 2: 121,101,089 C198S probably damaging Het
Ticrr T C 7: 79,679,135 F674S probably damaging Het
Tmem129 C A 5: 33,654,499 C31F probably damaging Het
Tmem132a T A 19: 10,858,688 D826V possibly damaging Het
Tpd52 T C 3: 8,953,802 probably null Het
Trub2 A G 2: 29,777,666 S321P probably benign Het
Ttc29 A G 8: 78,282,385 T295A probably benign Het
Tubb1 G A 2: 174,456,689 S89N probably benign Het
Ubap2 C A 4: 41,233,617 G91V probably damaging Het
Ugt2b35 A G 5: 87,001,288 N133D probably damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn1r220 A C 13: 23,184,287 C80G probably damaging Het
Vmn1r79 A G 7: 12,176,647 E152G probably benign Het
Vmn2r28 T C 7: 5,486,346 Y498C probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Zcchc11 T A 4: 108,529,300 F1122L probably damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zfp972 A G 2: 177,921,687 probably null Het
Other mutations in Pcdhga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
BB019:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
R1074:Pcdhga1 UTSW 18 37825087 splice site probably benign
R1871:Pcdhga1 UTSW 18 37840090 missense probably damaging 0.98
R3723:Pcdhga1 UTSW 18 37662992 missense possibly damaging 0.89
R3732:Pcdhga1 UTSW 18 37664123 missense probably benign 0.00
R4243:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4245:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4424:Pcdhga1 UTSW 18 37662579 missense probably damaging 0.97
R4898:Pcdhga1 UTSW 18 37662354 missense possibly damaging 0.63
R4941:Pcdhga1 UTSW 18 37662606 missense probably benign 0.10
R5021:Pcdhga1 UTSW 18 37663823 missense probably damaging 1.00
R5765:Pcdhga1 UTSW 18 37663661 missense probably benign 0.31
R6176:Pcdhga1 UTSW 18 37664229 missense probably benign 0.22
R6380:Pcdhga1 UTSW 18 37662969 missense probably damaging 1.00
R7062:Pcdhga1 UTSW 18 37825077 missense probably damaging 1.00
R7146:Pcdhga1 UTSW 18 37662111 missense probably benign 0.04
R7266:Pcdhga1 UTSW 18 37839975 missense possibly damaging 0.94
R7525:Pcdhga1 UTSW 18 37662228 missense probably damaging 1.00
R7553:Pcdhga1 UTSW 18 37749682 splice site probably null
R7581:Pcdhga1 UTSW 18 37662177 missense probably damaging 1.00
R7932:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
R8330:Pcdhga1 UTSW 18 37663323 missense probably benign 0.19
R8385:Pcdhga1 UTSW 18 37662096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACCCCATCTGACCATCTG -3'
(R):5'- TGTTTCTGTTTCCCAACGGG -3'

Sequencing Primer
(F):5'- TGCTGATGGGAGCTCTACC -3'
(R):5'- CCAACGGGGAGCATGGC -3'
Posted On2014-06-30