Incidental Mutation 'R0121:Fam111a'
ID21063
Institutional Source Beutler Lab
Gene Symbol Fam111a
Ensembl Gene ENSMUSG00000024691
Gene Namefamily with sequence similarity 111, member A
Synonyms
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location12545740-12589768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12584080 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000119518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025595] [ENSMUST00000144662] [ENSMUST00000151307]
Predicted Effect probably benign
Transcript: ENSMUST00000025595
AA Change: F12L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025595
Gene: ENSMUSG00000024691
AA Change: F12L

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 368 557 6.4e-15 PFAM
Pfam:Peptidase_S7 491 574 6.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139270
Predicted Effect probably benign
Transcript: ENSMUST00000144662
AA Change: F12L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119518
Gene: ENSMUSG00000024691
AA Change: F12L

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 355 557 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151307
SMART Domains Protein: ENSMUSP00000123598
Gene: ENSMUSG00000024691

DomainStartEndE-ValueType
low complexity region 267 276 N/A INTRINSIC
Pfam:Trypsin 309 536 6.6e-7 PFAM
Pfam:Trypsin_2 324 513 5.6e-15 PFAM
Pfam:Peptidase_S7 447 530 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224046
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is cell-cycle regulated, and has nuclear localization. The C-terminal half of the protein shares homology with trypsin-like peptidases and it contains a PCNA-interacting peptide (PIP) box, that is necessary for its co-localization with proliferating cell nuclear antigen (PCNA). Reduced expression of this gene resulted in DNA replication defects, consistent with the demonstrated role for this gene in Simian Virus 40 (SV40) viral replication. Mutations in this gene have been associated with Kenny-Caffey syndrome (KCS) type 2 and the more severe osteocraniostenosis (OCS, also known as Gracile Bone Dysplasia), both characterized by short stature, hypoparathyroidism, bone development abnormalities, and hypocalcemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Fam111a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Fam111a APN 19 12586954 missense probably damaging 0.96
IGL02721:Fam111a APN 19 12586972 missense probably benign 0.04
IGL02885:Fam111a APN 19 12584124 critical splice donor site probably null
R0524:Fam111a UTSW 19 12588048 missense probably damaging 1.00
R1553:Fam111a UTSW 19 12587318 missense possibly damaging 0.93
R1583:Fam111a UTSW 19 12587778 missense probably damaging 0.99
R1837:Fam111a UTSW 19 12587452 missense probably benign 0.23
R2945:Fam111a UTSW 19 12587866 nonsense probably null
R3732:Fam111a UTSW 19 12587550 missense possibly damaging 0.57
R4772:Fam111a UTSW 19 12587693 missense probably benign
R4773:Fam111a UTSW 19 12588408 missense possibly damaging 0.91
R4894:Fam111a UTSW 19 12588549 missense probably benign 0.12
R6177:Fam111a UTSW 19 12587382 missense probably damaging 1.00
R6269:Fam111a UTSW 19 12588443 missense probably benign 0.01
R6330:Fam111a UTSW 19 12586902 missense probably damaging 1.00
R6390:Fam111a UTSW 19 12588160 nonsense probably null
R6448:Fam111a UTSW 19 12588337 missense probably benign 0.04
R6813:Fam111a UTSW 19 12587342 missense probably damaging 1.00
R7620:Fam111a UTSW 19 12587937 missense possibly damaging 0.73
R8291:Fam111a UTSW 19 12587579 missense probably benign 0.01
X0010:Fam111a UTSW 19 12588228 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCCAGGTGACAGGATACAGTTCAG -3'
(R):5'- CAACAATGAGGCAGTTTCTTGGCAC -3'

Sequencing Primer
(F):5'- CTTGTGAGCCAGAATCTGAAGC -3'
(R):5'- TTGGCACTAGATCCTATGTAACC -3'
Posted On2013-04-11