Incidental Mutation 'R1870:Ccdc18'
ID 210633
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 1700021E15Rik, 4932411G06Rik
MMRRC Submission 039892-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1870 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 108280741-108381494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108368703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1275 (H1275R)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
AlphaFold Q640L5
Predicted Effect possibly damaging
Transcript: ENSMUST00000047677
AA Change: H1275R

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: H1275R

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,134 (GRCm39) E1332D probably benign Het
Abca5 C A 11: 110,220,043 (GRCm39) V8L probably benign Het
Abcc8 C T 7: 45,773,339 (GRCm39) E797K probably benign Het
Acd C A 8: 106,425,039 (GRCm39) probably null Het
Adam34l A T 8: 44,078,132 (GRCm39) Y697* probably null Het
Adamts12 T C 15: 11,311,240 (GRCm39) S1166P probably benign Het
Alox12b T C 11: 69,049,199 (GRCm39) Y83H possibly damaging Het
Antxr2 A T 5: 98,178,297 (GRCm39) S38T probably damaging Het
Aox1 A G 1: 58,115,262 (GRCm39) E749G probably damaging Het
Arpc1a T A 5: 145,043,901 (GRCm39) C344S possibly damaging Het
Bcan T C 3: 87,902,908 (GRCm39) Y290C probably damaging Het
Bod1l G A 5: 41,991,018 (GRCm39) S179F possibly damaging Het
Catsper3 A C 13: 55,953,561 (GRCm39) D224A probably damaging Het
Ccar2 A G 14: 70,377,946 (GRCm39) S680P probably damaging Het
Ccdc40 T C 11: 119,150,730 (GRCm39) M1011T possibly damaging Het
Cfap46 T A 7: 139,263,386 (GRCm39) D17V probably damaging Het
Csn1s2a T C 5: 87,926,058 (GRCm39) F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 (GRCm39) N750K possibly damaging Het
Cyb5r4 A G 9: 86,922,462 (GRCm39) D157G probably benign Het
D130040H23Rik T A 8: 69,755,354 (GRCm39) I253N probably benign Het
Dennd4a C T 9: 64,804,516 (GRCm39) A1285V probably benign Het
Dlat A G 9: 50,548,874 (GRCm39) S561P probably damaging Het
Dlgap2 T A 8: 14,823,347 (GRCm39) V522E probably damaging Het
Dnah5 T A 15: 28,331,859 (GRCm39) Y2148* probably null Het
Dnase2a T C 8: 85,635,392 (GRCm39) probably benign Het
Elapor2 A G 5: 9,468,007 (GRCm39) E225G probably damaging Het
Fam83f T C 15: 80,574,113 (GRCm39) probably benign Het
Firrm G A 1: 163,792,363 (GRCm39) L545F probably damaging Het
Foxi1 A T 11: 34,157,937 (GRCm39) N29K possibly damaging Het
Galk2 T C 2: 125,817,183 (GRCm39) L324P probably benign Het
Gdpd4 G A 7: 97,622,162 (GRCm39) V214I probably benign Het
Gfra3 C T 18: 34,844,373 (GRCm39) A56T probably damaging Het
Glyctk A G 9: 106,032,547 (GRCm39) S489P probably damaging Het
Izumo4 A T 10: 80,539,569 (GRCm39) I135F probably damaging Het
Krt87 T A 15: 101,385,071 (GRCm39) T342S probably benign Het
L1td1 T A 4: 98,625,714 (GRCm39) D636E possibly damaging Het
Letm2 A G 8: 26,086,460 (GRCm39) probably benign Het
Lpin1 A G 12: 16,591,744 (GRCm39) F828L probably damaging Het
Lrrc37 T C 11: 103,511,431 (GRCm39) D179G unknown Het
Mdn1 T A 4: 32,763,339 (GRCm39) D5146E probably damaging Het
Megf10 T A 18: 57,324,257 (GRCm39) Y99* probably null Het
Men1 A G 19: 6,387,660 (GRCm39) D285G probably damaging Het
Mertk T G 2: 128,643,116 (GRCm39) D838E probably benign Het
Mta1 T C 12: 113,091,694 (GRCm39) S266P possibly damaging Het
Mta3 G A 17: 84,089,397 (GRCm39) V320M probably damaging Het
Nlrp9c G A 7: 26,084,245 (GRCm39) Q445* probably null Het
Or2m12 A T 16: 19,105,357 (GRCm39) N45K probably damaging Het
Or51e1 T C 7: 102,358,961 (GRCm39) I165T possibly damaging Het
Or8b38 A T 9: 37,972,646 (GRCm39) K10I probably benign Het
Or8d6 T G 9: 39,854,117 (GRCm39) I187R probably damaging Het
Pbrm1 T A 14: 30,828,132 (GRCm39) L1320I probably damaging Het
Pdzd2 G T 15: 12,457,972 (GRCm39) T297K probably damaging Het
Pfas T C 11: 68,882,795 (GRCm39) D782G probably damaging Het
Pik3c3 T C 18: 30,426,185 (GRCm39) probably null Het
Pira2 T C 7: 3,847,452 (GRCm39) N79S probably damaging Het
Pkdrej G T 15: 85,700,632 (GRCm39) T1768K probably damaging Het
Plcb3 T C 19: 6,940,353 (GRCm39) I439V probably benign Het
Pold4 T A 19: 4,282,593 (GRCm39) Y58* probably null Het
Ppef2 T G 5: 92,398,371 (GRCm39) Q49P probably damaging Het
Ralgapa1 T A 12: 55,723,817 (GRCm39) I2026F possibly damaging Het
Rest T A 5: 77,416,209 (GRCm39) V141E possibly damaging Het
Rnf139 T C 15: 58,771,202 (GRCm39) V409A probably benign Het
Rnpc3 T C 3: 113,404,704 (GRCm39) probably benign Het
S100a10 A T 3: 93,468,377 (GRCm39) E36V probably benign Het
S1pr3 A C 13: 51,573,952 (GRCm39) K378Q probably benign Het
Scaper T A 9: 55,593,222 (GRCm39) I472F probably damaging Het
Sgcg G A 14: 61,477,896 (GRCm39) probably benign Het
Shank1 A T 7: 43,991,539 (GRCm39) R69* probably null Het
Shoc1 G A 4: 59,054,142 (GRCm39) probably benign Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Slc25a54 T A 3: 108,987,932 (GRCm39) Y24* probably null Het
Slc29a4 T C 5: 142,707,243 (GRCm39) *529R probably null Het
Slc41a2 G A 10: 83,137,029 (GRCm39) Q293* probably null Het
Slc4a7 T C 14: 14,737,509 (GRCm38) probably null Het
Slfn9 G T 11: 82,872,402 (GRCm39) T778N probably benign Het
Ssr2 T C 3: 88,483,949 (GRCm39) probably benign Het
Tecrl T A 5: 83,502,706 (GRCm39) T33S probably benign Het
Tnfrsf9 T A 4: 151,018,804 (GRCm39) C158* probably null Het
Tradd T C 8: 105,985,792 (GRCm39) E253G possibly damaging Het
Usp34 A G 11: 23,314,479 (GRCm39) H807R probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vmn2r27 T C 6: 124,201,170 (GRCm39) I262M probably benign Het
Vps13a A G 19: 16,737,316 (GRCm39) V91A probably damaging Het
Vwf C T 6: 125,619,902 (GRCm39) R1527C probably damaging Het
Wwc1 C T 11: 35,752,772 (GRCm39) G763D probably damaging Het
Zfp526 T G 7: 24,924,594 (GRCm39) D284E possibly damaging Het
Zfp646 T C 7: 127,483,021 (GRCm39) F1733L possibly damaging Het
Zfp90 A G 8: 107,145,755 (GRCm39) H29R probably benign Het
Zkscan4 A G 13: 21,668,104 (GRCm39) E185G probably benign Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108,328,391 (GRCm39) missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108,328,753 (GRCm39) missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108,350,052 (GRCm39) splice site probably benign
IGL01718:Ccdc18 APN 5 108,349,214 (GRCm39) missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108,349,977 (GRCm39) missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108,296,788 (GRCm39) missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108,283,918 (GRCm39) missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108,319,614 (GRCm39) missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108,283,835 (GRCm39) splice site probably benign
IGL02880:Ccdc18 APN 5 108,283,310 (GRCm39) missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108,376,767 (GRCm39) missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108,359,997 (GRCm39) missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108,306,485 (GRCm39) missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108,309,566 (GRCm39) missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108,321,627 (GRCm39) missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108,321,655 (GRCm39) missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108,322,830 (GRCm39) missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108,328,282 (GRCm39) missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108,322,853 (GRCm39) missense probably damaging 1.00
R0648:Ccdc18 UTSW 5 108,283,426 (GRCm39) missense probably damaging 0.99
R0666:Ccdc18 UTSW 5 108,311,530 (GRCm39) missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108,349,982 (GRCm39) nonsense probably null
R1509:Ccdc18 UTSW 5 108,336,844 (GRCm39) missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108,339,843 (GRCm39) missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108,360,054 (GRCm39) missense probably benign
R1663:Ccdc18 UTSW 5 108,363,956 (GRCm39) missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108,341,668 (GRCm39) missense probably benign 0.00
R1897:Ccdc18 UTSW 5 108,343,908 (GRCm39) missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108,376,861 (GRCm39) missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4079:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4244:Ccdc18 UTSW 5 108,296,838 (GRCm39) nonsense probably null
R4409:Ccdc18 UTSW 5 108,368,708 (GRCm39) nonsense probably null
R4428:Ccdc18 UTSW 5 108,283,943 (GRCm39) missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108,309,395 (GRCm39) missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108,376,826 (GRCm39) missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108,283,307 (GRCm39) missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108,284,007 (GRCm39) missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108,339,869 (GRCm39) missense probably benign
R5039:Ccdc18 UTSW 5 108,306,514 (GRCm39) critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108,288,740 (GRCm39) missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108,354,594 (GRCm39) missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108,311,625 (GRCm39) missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108,319,484 (GRCm39) missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108,322,753 (GRCm39) missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108,309,448 (GRCm39) missense probably benign
R6359:Ccdc18 UTSW 5 108,283,391 (GRCm39) missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108,322,820 (GRCm39) missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108,349,214 (GRCm39) missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108,309,612 (GRCm39) missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108,339,790 (GRCm39) missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108,286,796 (GRCm39) missense probably benign
R6664:Ccdc18 UTSW 5 108,315,966 (GRCm39) nonsense probably null
R6836:Ccdc18 UTSW 5 108,345,833 (GRCm39) missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108,309,401 (GRCm39) missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108,321,728 (GRCm39) critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108,309,554 (GRCm39) missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108,341,664 (GRCm39) missense probably benign
R7087:Ccdc18 UTSW 5 108,343,988 (GRCm39) missense probably benign
R7117:Ccdc18 UTSW 5 108,296,835 (GRCm39) missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108,315,972 (GRCm39) missense probably benign
R7382:Ccdc18 UTSW 5 108,286,873 (GRCm39) missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108,368,716 (GRCm39) missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108,354,483 (GRCm39) nonsense probably null
R7506:Ccdc18 UTSW 5 108,311,605 (GRCm39) missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108,376,915 (GRCm39) critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108,376,528 (GRCm39) missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108,296,907 (GRCm39) critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108,328,699 (GRCm39) missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8019:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8172:Ccdc18 UTSW 5 108,311,640 (GRCm39) critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108,345,661 (GRCm39) missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108,309,369 (GRCm39) missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108,363,899 (GRCm39) missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108,345,725 (GRCm39) missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108,328,283 (GRCm39) missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108,296,856 (GRCm39) missense probably damaging 0.98
R9391:Ccdc18 UTSW 5 108,376,770 (GRCm39) missense probably benign 0.02
R9418:Ccdc18 UTSW 5 108,303,669 (GRCm39) missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108,286,792 (GRCm39) missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108,339,800 (GRCm39) missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108,368,582 (GRCm39) missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108,339,788 (GRCm39) missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108,360,063 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGGTATTAGAATAACTCCATCC -3'
(R):5'- ATGAACACACAGTGTAGGCC -3'

Sequencing Primer
(F):5'- CTCAGAAGACGTCTGTTC -3'
(R):5'- TTTAAGGCACATCAGATATAAAACCC -3'
Posted On 2014-06-30